Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Mus musculus
Genetic Insert: PPARalpha
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4000; Vector Backbone:pSG5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: The PPARa cDNA was isolated from an adipocyte lambda ZAPII cDNA library (Tontonoz et al 1994 Genes Dev 8:1224-1234).
Proper citation: RRID:Addgene_22751 Copy
Species: Mus musculus
Genetic Insert: Trp53
Vector Backbone Description: Backbone Size:4600; Vector Backbone:pMXs-gw; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19668191
Comments: additional article reference: Shinmura, K. et al. Direct evidence for the role of centrosomally localized p53 in the regulation of centrosome duplication. Oncogene. 2007 May 3;26(20):2939-44. Epub 2006 Oct 30.
Proper citation: RRID:Addgene_22727 Copy
Species: Mus musculus
Genetic Insert: Trp53
Vector Backbone Description: Backbone Size:4600; Vector Backbone:pMXs-gw; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19668191
Comments: additional article reference: Bowman, T. et al. Tissue-specific inactivation of p53 tumor suppression in the mouse. Genes Dev. 1996 Apr 1;10(7):826-35.
Proper citation: RRID:Addgene_22729 Copy
Species: mushroom
Genetic Insert: a variant of Discosoma sp. red fluorescent protein
Vector Backbone Description: Backbone Marker:Dr. Toshio Kitamura of the University of Tokyo; Backbone Size:4800; Vector Backbone:pMXs; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19668191
Proper citation: RRID:Addgene_22724 Copy
Species: Mus musculus
Genetic Insert: Trp53
Vector Backbone Description: Backbone Size:4600; Vector Backbone:pMXs-gw; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19668191
Proper citation: RRID:Addgene_22725 Copy
Species: Homo sapiens
Genetic Insert: E1A-like inhibitor of differentiation 1
Vector Backbone Description: Backbone Marker:Pharmacia; Backbone Size:4938; Vector Backbone:pGex2T; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11073989
Proper citation: RRID:Addgene_22689 Copy
Genetic Insert: Lox71-FRT-PGK-hygro-FRT-Lox2272
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:3060; Vector Backbone:pBluescript KS+; Vector Types:Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21324933
Comments: Please note that the plasmid names and lox sites have been corrected since publication.
Proper citation: RRID:Addgene_22731 Copy
Genetic Insert: miR30
Vector Backbone Description: Backbone Size:7500; Vector Backbone:MSCV2.2 with WPRE cloned into ClaI site is the base vector; Vector Types:Mammalian Expression, Retroviral, RNAi; Bacterial Resistance:Ampicillin
Comments: See FLIP vector protocols (PDF from this page) for more information.
This vector contains the SwaI site for cloning multiple shRNAs into a single vector.
Proper citation: RRID:Addgene_22699 Copy
Genetic Insert: Lox71-MCS-Lox2272
Vector Backbone Description: Backbone Size:2905; Vector Backbone:pBluescript KS+; Vector Types:Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21324933
Comments: Please note that the plasmid names and lox sites have been corrected since publication.
Proper citation: RRID:Addgene_22732 Copy
Genetic Insert: Lox66-pU(delta)TK-EM7Neo-Lox2272
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:2969; Vector Backbone:pBluescript KS+; Vector Types:Cre/Lox, BAC recombineering; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21324933
Comments: Please note that the plasmid names and lox sites have been corrected since publication.
Proper citation: RRID:Addgene_22733 Copy
Species: Homo sapiens
Genetic Insert: miR-31
Vector Backbone Description: Backbone Marker:Weinberg lab (Addgene#:1764); Backbone Size:5169; Vector Backbone:pBABE-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19524507
Comments: Useful for stable suppression of miR-31 function.
Original sponge backbone modifed from Ebert et al., Nat. Methods (2007); miR-31 construct and stable design are novel
Repeated sequence is: AGGCAAGACGAGGCATAGCT
*Addgene sequencing found at least partial EGFP upstream of the sponge. We do not know if the EGFP is functional or a side-product of the cloning.
Proper citation: RRID:Addgene_22694 Copy
Species: Drosophila melanogaster
Genetic Insert: micro-RNA-92b
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5348; Vector Backbone:pAc5.1A; Vector Types:Drosophila expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17901217
Proper citation: RRID:Addgene_22709 Copy
Species: Homo sapiens
Genetic Insert: Egg laying Nine - 2 (EglN2)
Vector Backbone Description: Backbone Size:5145; Vector Backbone:pBabe-Puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19878873
Proper citation: RRID:Addgene_22705 Copy
Species: Mus musculus
Genetic Insert: Inhibitor of DNA binding 1
Vector Backbone Description: Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19896442
Comments: This plasmid is identical to Plasmid 22664: pId1-B.IRES-Venus.
Proper citation: RRID:Addgene_22668 Copy
Species: Drosophila melanogaster
Genetic Insert: micro RNA 6-1, micro RNA 6-2, micro RNA 6-3
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5348; Vector Backbone:pAc5.1A; Vector Types:Drosophila expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16581772
Proper citation: RRID:Addgene_22789 Copy
Genetic Insert: NeoR
Vector Backbone Description: Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19896442
Proper citation: RRID:Addgene_22669 Copy
Species: Homo sapiens
Genetic Insert: cyclin D1
Vector Backbone Description: Backbone Size:5536; Vector Backbone:pBabe-Puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19878873
Proper citation: RRID:Addgene_22703 Copy
Genetic Insert: IRES-Venus
Vector Backbone Description: Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19896442
Proper citation: RRID:Addgene_22665 Copy
Genetic Insert: A DNA containing CHLI fragment
Vector Backbone Description: Backbone Size:5702; Vector Backbone:pBluescript SK+ II (original backbone); Vector Types:RNAi, Arabidopsis VIGS vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11967097
Comments: Has a 360-bp CHLI insert as a visual marker for silencing cloned into A-DNA vector. magnesium chelatase subunit I.
--Must be bombarded with appropriate B DNA for systemic infection
Proper citation: RRID:Addgene_22786 Copy
Genetic Insert: B DNA
Vector Backbone Description: Backbone Size:6854; Vector Backbone:pBluescript SK+ II (original backbone); Vector Types:RNAi, Arabidopsis VIGS vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11967097
Proper citation: RRID:Addgene_22787 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
