Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Canis lupus familiaris
Genetic Insert: Caveolin1 (1-61)
Vector Backbone Description: Backbone Size:4900; Vector Backbone:pGEX-4T-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9325253
Proper citation: RRID:Addgene_22446 Copy
Species: Canis lupus familiaris
Genetic Insert: Caveolin1 (61-101)
Vector Backbone Description: Backbone Size:4900; Vector Backbone:pGEX-4T-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9325253
Proper citation: RRID:Addgene_22447 Copy
Genetic Insert: CMV d2eGFP miR-16 sponge
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pcDNA5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17694064
Comments: From supplementary Table 1: miR-16 bulged Renilla luciferase reporter, CMV sponge, and U6 sponge, 9 sites:
"AAUAUUCUAUGCUGCUA"
Proper citation: RRID:Addgene_22442 Copy
Species: Homo sapiens
Genetic Insert: Myoferlin
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5467; Vector Backbone:pcDNA3.1(-); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17702744
Comments: Please note that the myoferlin insert in this plasmid contains K110R, K605R and I1821V mutations when compared to GenBank reference sequence AF182316. It is not known if these are polymorphisms or PCR artifacts.
The source of the human myoferlin gene used in this plasmid is described in the following publication: https://www.ncbi.nlm.nih.gov/pubmed/17702744
Proper citation: RRID:Addgene_22443 Copy
Genetic Insert: EGFP
Vector Backbone Description: Backbone Size:3000; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:17948311
Proper citation: RRID:Addgene_22453 Copy
Species: Homo sapiens
Genetic Insert: eNOS promotor F1
Vector Backbone Description: Backbone Size:5854; Vector Backbone:pGL2- Enhancer; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:7541039
Proper citation: RRID:Addgene_22426 Copy
Species: Homo sapiens
Genetic Insert: F3
Vector Backbone Description: Backbone Size:5854; Vector Backbone:pGL2 enhancer; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:7541039
Proper citation: RRID:Addgene_22429 Copy
Vector Backbone Description: Backbone Size:5808; Vector Backbone:pCS2+; Vector Types:; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:17948311
Comments: pCS2+ was digested with Stu I and ligated with the Reading Frame B Gateway cassette
Proper citation: RRID:Addgene_22423 Copy
Vector Backbone Description: Backbone Size:5800; Vector Backbone:pCS2+; Vector Types:Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:17948311
Comments: pCSDest was digested with PstI and XhoI to remove the attR2 site and was replaced with an attR3 site from pDESTR4-R3
Proper citation: RRID:Addgene_22424 Copy
Species: Drosophila melanogaster
Genetic Insert: Argonaut-1, variant A
Vector Backbone Description: Backbone Marker:Elisa Izaurralde; Backbone Size:5455; Vector Backbone:pac5.1B-lambdaN; Vector Types:Drosophila expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16177138
Proper citation: RRID:Addgene_22420 Copy
Species: Homo sapiens
Genetic Insert: F6
Vector Backbone Description: Backbone Size:5854; Vector Backbone:pGL2 enhancer; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:7541039
Proper citation: RRID:Addgene_22438 Copy
Species: Homo sapiens
Genetic Insert: F6 Sp-1 mut
Vector Backbone Description: Backbone Size:5854; Vector Backbone:pGL2 enhancer; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:7541039
Comments: Sp1 mutation (−103) oligo is - GGATAGGGACTGGGCGAGG
Proper citation: RRID:Addgene_22439 Copy
Species: Homo sapiens
Genetic Insert: F4
Vector Backbone Description: Backbone Size:5854; Vector Backbone:pGL2 enhancer; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:7541039
Proper citation: RRID:Addgene_22434 Copy
Species: Homo sapiens
Genetic Insert: F4 GATA mut
Vector Backbone Description: Backbone Size:5854; Vector Backbone:pGL2 enhancer; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:7541039
Comments: GATA mutation oigo -
GCTCCCACTTTAGAGCCTCAGT
Proper citation: RRID:Addgene_22435 Copy
Species: Homo sapiens
Genetic Insert: F5
Vector Backbone Description: Backbone Size:5854; Vector Backbone:pGL2 enhancer; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:7541039
Proper citation: RRID:Addgene_22436 Copy
Species: Homo sapiens
Genetic Insert: F3 GATA Sp-1 mut
Vector Backbone Description: Backbone Size:5854; Vector Backbone:pGL2 enhancer; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:7541039
Comments: The forward primer used for the Sp1 mutations (-103) was GGATAGGGACTGGGCGAGG.
GATA mutation oigo -
GCTCCCACTTTAGAGCCTCAGT.
Proper citation: RRID:Addgene_22431 Copy
Species: Homo sapiens
Genetic Insert: F3 Sp-1 mut
Vector Backbone Description: Backbone Size:5854; Vector Backbone:pGL2 enhancer; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:7541039
Comments: Forward primer used to create Sp-1 mutation: GGATAGGGACTGGGCGAGG
Proper citation: RRID:Addgene_22432 Copy
Species: Homo sapiens
Genetic Insert: Human genomic PLP
Vector Backbone Description: Backbone Marker:Fermentas; Backbone Size:2862; Vector Backbone:pTZ19R; Vector Types:phagemid; Bacterial Resistance:Ampicillin
Defining Citation: PMID:2479017
Comments: Genomic DNA from an EMBL3 human genomic library. Contains 3' end of Exon1, Intron 1, Exon 2 and Intron 2
Proper citation: RRID:Addgene_22647 Copy
Species: Rattus norvegicus
Genetic Insert: Myelin Transcription Factor 1L
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:2743; Vector Backbone:pGEM-3Z; Vector Types:Cloning and RNA Synthesis; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9373037
Comments: Used to make riboprobes by cutting with SmaI and transcribing with SP6 polymerase to give a 980 bp riboprobe for RNA analysis on Northern blots
This Rat Myt1 DNA cloned by Hudson lab.
Proper citation: RRID:Addgene_22649 Copy
Species: Homo sapiens
Genetic Insert: BAP1
Vector Backbone Description: Backbone Marker:Harper_Lab; Backbone Size:6521; Vector Backbone:pDEST_LTR_N_FLAG_HA_IRES_puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19615732
Proper citation: RRID:Addgene_22539 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
