Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
On page 215 showing 4281 ~ 4300 out of 742,877 results
Snippet view Table view Download Top 1000 Results

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

    • RRID:Addgene_209959

    This resource has 1+ mentions.

http://www.addgene.org/209959

Vector Backbone Description: Vector Backbone:pLP4; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39254046

Proper citation: RRID:Addgene_209959 Copy   

    • RRID:Addgene_209969

    This resource has 1+ mentions.

http://www.addgene.org/209969

Species: L. plantarum
Genetic Insert: Promoter (P_fabZ)
Vector Backbone Description: Vector Backbone:pLP1; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:39254046

Proper citation: RRID:Addgene_209969 Copy   

    • RRID:Addgene_209966

    This resource has 1+ mentions.

http://www.addgene.org/209966

Species: Synthetic
Genetic Insert: Promoter (P40)
Vector Backbone Description: Vector Backbone:pLP1; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:39254046

Proper citation: RRID:Addgene_209966 Copy   

    • RRID:Addgene_209967

    This resource has 1+ mentions.

http://www.addgene.org/209967

Species: Lactobacillus sakei
Genetic Insert: Promoter (P_sppQ)
Vector Backbone Description: Vector Backbone:pLP1; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:39254046

Proper citation: RRID:Addgene_209967 Copy   

    • RRID:Addgene_209960

    This resource has 1+ mentions.

http://www.addgene.org/209960

Vector Backbone Description: Vector Backbone:pLP5; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39254046

Proper citation: RRID:Addgene_209960 Copy   

    • RRID:Addgene_209961

    This resource has 1+ mentions.

http://www.addgene.org/209961

Vector Backbone Description: Vector Backbone:pLP6; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39254046

Proper citation: RRID:Addgene_209961 Copy   

    • RRID:Addgene_209970

    This resource has 1+ mentions.

http://www.addgene.org/209970

Species: L. plantarum
Genetic Insert: Promoter (P_gadB)
Vector Backbone Description: Vector Backbone:pLP1; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:39254046

Proper citation: RRID:Addgene_209970 Copy   

http://www.addgene.org/223518

Species: Mus musculus
Genetic Insert: GSDME
Vector Backbone Description: Vector Backbone:pLVX-puro; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32188940

Proper citation: RRID:Addgene_223518 Copy   

    • RRID:Addgene_194341

http://www.addgene.org/194341

Genetic Insert: Cas13a(Lse)
Vector Backbone Description: Vector Backbone:pUC18-mini-Tn7T-LAC; Vector Types:Bacterial Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:31819262

Proper citation: RRID:Addgene_194341 Copy   

http://www.addgene.org/212339

Species: Severe acute respiratory syndrome coronavirus 2
Genetic Insert: SARS-CoV-2 Spike A570D
Vector Backbone Description: Backbone Marker:Twist; Vector Backbone:pTwist-CMV-BetaGlobin-WPRE-Neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38496628
Comments: Please visit https://www.medrxiv.org/content/10.1101/2024.03.05.24303815v1 for medRxiv preprint.

Proper citation: RRID:Addgene_212339 Copy   

http://www.addgene.org/212338

Species: Severe acute respiratory syndrome coronavirus 2
Genetic Insert: SARS-CoV-2 Spike N501Y
Vector Backbone Description: Backbone Marker:Twist; Vector Backbone:pTwist-CMV-BetaGlobin-WPRE-Neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38496628
Comments: Please visit https://www.medrxiv.org/content/10.1101/2024.03.05.24303815v1 for medRxiv preprint.

Proper citation: RRID:Addgene_212338 Copy   

http://www.addgene.org/212337

Species: Severe acute respiratory syndrome coronavirus 2
Genetic Insert: SARS-CoV-2 Spike Y145H
Vector Backbone Description: Backbone Marker:Twist; Vector Backbone:pTwist-CMV-BetaGlobin-WPRE-Neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38496628
Comments: Please visit https://www.medrxiv.org/content/10.1101/2024.03.05.24303815v1 for medRxiv preprint.

Proper citation: RRID:Addgene_212337 Copy   

http://www.addgene.org/212336

Species: Severe acute respiratory syndrome coronavirus 2
Genetic Insert: SARS-CoV-2 Spike deltaH69, deltaH70
Vector Backbone Description: Backbone Marker:Twist; Vector Backbone:pTwist-CMV-BetaGlobin-WPRE-Neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38496628
Comments: Please visit https://www.medrxiv.org/content/10.1101/2024.03.05.24303815v1 for medRxiv preprint.

Proper citation: RRID:Addgene_212336 Copy   

http://www.addgene.org/212334

Species: Severe acute respiratory syndrome coronavirus 2
Genetic Insert: SARS-CoV-2 Spike D936Y
Vector Backbone Description: Backbone Marker:Twist; Vector Backbone:pTwist-CMV-BetaGlobin-WPRE-Neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38496628
Comments: Please visit https://www.medrxiv.org/content/10.1101/2024.03.05.24303815v1 for medRxiv preprint.

Proper citation: RRID:Addgene_212334 Copy   

    • RRID:Addgene_209979

    This resource has 1+ mentions.

http://www.addgene.org/209979

Species: Lactobacillus reuteri
Genetic Insert: resistance cassette (ermBL)
Vector Backbone Description: Vector Backbone:pLP2; Vector Types:Bacterial Expression; Bacterial Resistance:Erythromycin
Defining Citation: PMID:39254046

Proper citation: RRID:Addgene_209979 Copy   

    • RRID:Addgene_209975

    This resource has 1+ mentions.

http://www.addgene.org/209975

Species: L. plantarum
Genetic Insert: replication origin (256_rep)
Vector Backbone Description: Vector Backbone:pLP1; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:39254046

Proper citation: RRID:Addgene_209975 Copy   

http://www.addgene.org/223227

Species: Mus musculus
Genetic Insert: Fev
Vector Backbone Description: Backbone Size:5270; Vector Backbone:pAAV-U6-sgRNA-hSyn-mCherry-KASH; Vector Types:Mammalian Expression, Mouse Targeting, AAV, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39147805
Comments: gRNA target sequence: GCCGCGCCACCTCGTCCGGGTCGG

Proper citation: RRID:Addgene_223227 Copy   

    • RRID:Addgene_209977

    This resource has 1+ mentions.

http://www.addgene.org/209977

Species: L. plantarum
Genetic Insert: replication origin (pAMBeta1)
Vector Backbone Description: Vector Backbone:pLP1; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:39254046

Proper citation: RRID:Addgene_209977 Copy   

    • RRID:Addgene_209971

    This resource has 1+ mentions.

http://www.addgene.org/209971

Species: L. plantarum
Genetic Insert: Promoter (P_ldhD)
Vector Backbone Description: Vector Backbone:pLP1; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:39254046

Proper citation: RRID:Addgene_209971 Copy   

http://www.addgene.org/223226

Species: Mus musculus
Genetic Insert: Nr1d1
Vector Backbone Description: Backbone Size:5270; Vector Backbone:pAAV-U6-sgRNA-hSyn-mCherry-KASH; Vector Types:Mammalian Expression, Mouse Targeting, AAV, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39147805

Proper citation: RRID:Addgene_223226 Copy   

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X

  1. Neuroscience Information Framework Resources

    Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within NIF that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X

About

Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web.  We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.

Recent News Entries

Recommendations for repositories and scientific gateways from a neuroscience perspective

NEURON course at the CNS meeting

Neuron Course this year has just been announced!

Contact Us

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch