Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 214 showing 4261 ~ 4280 out of 742,877 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_22417

    This resource has 1+ mentions.

http://www.addgene.org/22417

Species: Danio rerio
Genetic Insert: vegf
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pCS2+; Vector Types:zebrafish expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12110173

Proper citation: RRID:Addgene_22417 Copy   


http://www.addgene.org/22532

Genetic Insert: sh Ataxia telangiectasia mutated
Vector Backbone Description: Backbone Size:8459; Vector Backbone:p156RRL-sinPPT-CMV-GFP-PRE/Nhe I; Vector Types:Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Comments: shATM #2 was used successfully in Rodier et al.(2009) Nat.Cell Biol. 11(8):973-979.

Proper citation: RRID:Addgene_22532 Copy   


  • RRID:Addgene_22533

    This resource has 1+ mentions.

http://www.addgene.org/22533

Species: Gallus gallus
Genetic Insert: OVA
Vector Backbone Description: Backbone Marker:Kedes Lab; Backbone Size:10200; Vector Backbone:pHBetaAPr-1-neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:3261634
Comments: The OVA cDNA was removed from pOVA(230) (McReynolds et al., 1978) by digestion with EcoRI and subcloned into the polylinker of pUG-1. This provided convenient BglII and HindIII restriction sites adjacent to the ovalbumin cDNA for direct subcloning into the BamHI-HindIII site of the pHBetaAPr-1-neo express vector.

Proper citation: RRID:Addgene_22533 Copy   


  • RRID:Addgene_22534

    This resource has 1+ mentions.

http://www.addgene.org/22534

Species: Homo sapiens
Genetic Insert: Kif1bβ
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5362; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18334619

Proper citation: RRID:Addgene_22534 Copy   


http://www.addgene.org/22535

Species: Homo sapiens
Genetic Insert: hypoxia inducible factor 1 alpha
Vector Backbone Description: Backbone Size:6262; Vector Backbone:pCAG IGd2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19131628

Proper citation: RRID:Addgene_22535 Copy   


  • RRID:Addgene_22497

    This resource has 1+ mentions.

http://www.addgene.org/22497

Genetic Insert: WT eNOS
Vector Backbone Description: Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17170139

Proper citation: RRID:Addgene_22497 Copy   


http://www.addgene.org/22530

Genetic Insert: sh Enhanced Green Fluorescent Protein #1
Vector Backbone Description: Backbone Size:5596; Vector Backbone:p156RRL-sinPPT-CMV-GFP-PRE/Nhe I; Vector Types:Lentiviral, RNAi; Bacterial Resistance:Bleocin (Zeocin)

Proper citation: RRID:Addgene_22530 Copy   


http://www.addgene.org/22492

Species: Homo sapiens
Genetic Insert: Codon optimised wild type Calcineurin B
Vector Backbone Description: Backbone Size:7678; Vector Backbone:SFG; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19770360

Proper citation: RRID:Addgene_22492 Copy   


http://www.addgene.org/22490

Species: Homo sapiens
Genetic Insert: Codon optimised Calcineurin A mutant 12
Vector Backbone Description: Backbone Size:7678; Vector Backbone:SFG; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19770360

Proper citation: RRID:Addgene_22490 Copy   


http://www.addgene.org/22505

Species: Mus musculus
Genetic Insert: NEMO shRNA1
Vector Backbone Description: Backbone Marker:Available at Addgene (#12084); Backbone Size:7700; Vector Backbone:pSicoR PGK puro; Vector Types:Mammalian Expression, Lentiviral, RNAi, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19847165
Comments: Mouse NEMO shRNA1 in pSicoReverse (Puromycin) forward oligo: TGGACATGCTGGGTGAAGAATTCAAGAGATTCTTCACCCAGCATGTCCTTTTTTC reverse oligo : TCGAGAAAAAAGGACATGCTGGGTGAAGAATCTCTTGAATTCTTCACCCAGCATGTCCA

Proper citation: RRID:Addgene_22505 Copy   


  • RRID:Addgene_22468

    This resource has 1+ mentions.

http://www.addgene.org/22468

Species: Homo sapiens
Genetic Insert: cytochrome c
Vector Backbone Description: Backbone Marker:PMID 9558351); Backbone Size:5279; Vector Backbone:pBCYC1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:14680826
Comments: For an explanation of the cytochrome c expression system, see "Bacterial expression of a mitochondrial cytochrome c. Trimethylation of lys72 in yeast iso-1-cytochrome c and the alkaline conformational transition." by Pollock et al. PMID 9558351

Proper citation: RRID:Addgene_22468 Copy   


  • RRID:Addgene_22462

http://www.addgene.org/22462

Genetic Insert: EGFP
Vector Backbone Description: Backbone Size:3000; Vector Backbone:pDONRP2r-P3; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:17948311
Comments: This clone was amplified with an attB2 site, at the 5’ end and a attB3 site on the 3’ end. The product was then recombined with the pDNR P2R-P3 vector. Can be used to make 3’ end (C-Term) tagged fusion construct.

Proper citation: RRID:Addgene_22462 Copy   


  • RRID:Addgene_22464

http://www.addgene.org/22464

Genetic Insert: EGFP
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pDONR; Vector Types:Entry clone; Bacterial Resistance:Kanamycin
Defining Citation: PMID:17948311
Comments: Egfp ORF was amplified with an attB1 site on the 5’ end and an attB2 site on the 3’ end. ORF is in frame with 3’ entry clone. Egfp ORF missing the termination codon.

Proper citation: RRID:Addgene_22464 Copy   


  • RRID:Addgene_22465

http://www.addgene.org/22465

Genetic Insert: EGFP-mCherry
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pCS2+; Vector Types:Injection construct; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17948311
Comments: pEntregfp3, p3Emcherry, and pCSDest2 were combined in a multisite reaction to create an expression clone where egfp (minus stop codon) is fused in frame with a C terminal mcherry tag

Proper citation: RRID:Addgene_22465 Copy   


  • RRID:Addgene_22515

    This resource has 1+ mentions.

http://www.addgene.org/22515

Species: Merkel Cell Polyomavirus
Genetic Insert: MCPyV VP1
Vector Backbone Description: Backbone Size:5338; Vector Backbone:pGwf; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:19750217
Comments: First reference to this plasmid was in: Human Merkel cell polyomavirus infection II. MCV is a common human infection that can be detected by conformational capsid epitope immunoassays. Tolstov YL, Pastrana DV, Feng H, Becker JC, Jenkins FJ, Moschos S, Chang Y, Buck CB, Moore PS. Int J Cancer. 2009 Sep 15.125(6):1250-6 Genbank style annotations can be found at: http://home.ccr.cancer.gov/LCO/packaging.htm

Proper citation: RRID:Addgene_22515 Copy   


  • RRID:Addgene_22478

    This resource has 10+ mentions.

http://www.addgene.org/22478

Species: Discosoma sp
Genetic Insert: tandem dimer tomato
Vector Backbone Description: Backbone Marker:I. Verma, Salk; Backbone Size:9165; Vector Backbone:FUGW; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18162542
Comments: pFUGW-tdtomato

Proper citation: RRID:Addgene_22478 Copy   


  • RRID:Addgene_22513

    This resource has 1+ mentions.

http://www.addgene.org/22513

Species: Caenorhabditis elegans
Genetic Insert: Pmex-5::mCherry (w introns w/o stop)
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2646; Vector Backbone:pDONRP4P1R; Vector Types:Worm Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21637852

Proper citation: RRID:Addgene_22513 Copy   


  • RRID:Addgene_22474

http://www.addgene.org/22474

Species: Mus musculus
Genetic Insert: PIF6APB
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5369; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19749742

Proper citation: RRID:Addgene_22474 Copy   


  • RRID:Addgene_22471

http://www.addgene.org/22471

Species: Mus musculus
Genetic Insert: PhyB NT
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5369; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19749742

Proper citation: RRID:Addgene_22471 Copy   


  • RRID:Addgene_22448

    This resource has 1+ mentions.

http://www.addgene.org/22448

Species: Canis lupus familiaris
Genetic Insert: Caveolin 1
Vector Backbone Description: Backbone Size:4900; Vector Backbone:pGEX-4T-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9325253

Proper citation: RRID:Addgene_22448 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. Neuroscience Information Framework Resources

    Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within NIF that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X