Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Mus musculus
Genetic Insert: IL23R
Vector Backbone Description: Backbone Size:6000; Vector Backbone:pMIGR; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Comments: IL23R cDNA amplified through IL6 treated cDNA as 2 parts (5' part ATG-134-BamHI; 3' part 134-STOP).
5' part cloned into pcDNA3 XhoI/BamHI
3' part cloned into MSCV hCD2
Part linked together in pcDNA3 (XhoI-MluI)
Then cut with XhoI/NruI cloned into pMIGR (XhoI/HpaI)
Proper citation: RRID:Addgene_24066 Copy
Species: Homo sapiens
Genetic Insert: HP1 gamma
Vector Backbone Description: Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11959914
Proper citation: RRID:Addgene_24080 Copy
Species: Homo sapiens
Genetic Insert: HP1 gamma
Vector Backbone Description: Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11959914
Proper citation: RRID:Addgene_24081 Copy
Species: Homo sapiens
Genetic Insert: HP1 gamma
Vector Backbone Description: Backbone Size:4900; Vector Backbone:pGEX-4T-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11959914
Proper citation: RRID:Addgene_24076 Copy
Species: Homo sapiens
Genetic Insert: HP1 gamma
Vector Backbone Description: Backbone Size:4900; Vector Backbone:pGEX-4T-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11959914
Proper citation: RRID:Addgene_24077 Copy
Species: Mus musculus
Genetic Insert: Foxp3
Vector Backbone Description: Backbone Marker:Open Biosystems; Backbone Size:7894; Vector Backbone:MSCV-LTRmiR30-PIG (LMP); Vector Types:Retroviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18368049
Comments: The target sequence of Foxp3: 5′-GGCAGAGGACACTCAATGAAAT-3′
Proper citation: RRID:Addgene_24071 Copy
Species: Homo sapiens
Genetic Insert: HP1 alpha
Vector Backbone Description: Backbone Size:4900; Vector Backbone:pGEX-4T-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11959914
Proper citation: RRID:Addgene_24074 Copy
Species: Rattus norvegicus
Genetic Insert: NR1
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pCI; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16481433
Comments: The super-ecliptic pHluorin (SEP) coding sequence was inserted three amino acids downstream of the predicted signal peptide cleavage site.
Proper citation: RRID:Addgene_23999 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: rRNA 5'ETS ntds 923 to 1179
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pTOPO; Vector Types:Bacterial Cloning - TOPO; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:15489292
Proper citation: RRID:Addgene_23995 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: 25S rRNA from +5270 to oligo y
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pTOPO; Vector Types:Bacterial Cloning - TOPO; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:15489292
Proper citation: RRID:Addgene_23996 Copy
Species: Rattus norvegicus
Genetic Insert: NR2A
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pCI; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16481433
Comments: See attached map for additional plasmid features.
The super-ecliptic pHluorin (SEP) coding sequence was inserted three amino acids downstream of the predicted signal peptide cleavage site.
Proper citation: RRID:Addgene_23997 Copy
Species: Rattus norvegicus
Genetic Insert: NR2B
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pCI; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16481433
Comments: See attached map for additional plasmid features.
The super-ecliptic pHluorin (SEP) coding sequence was inserted three amino acids downstream of the predicted signal peptide cleavage site.
Proper citation: RRID:Addgene_23998 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: rDNA 5'ETS ntds 1 to 177
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pTOPO; Vector Types:Bacterial Cloning - TOPO; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:15489292
Proper citation: RRID:Addgene_23993 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: KAP123
Vector Backbone Description: Backbone Marker:Rosemary Williams (Rout Lab); Backbone Size:7100; Vector Backbone:pYEX-U (modified pYEX-BX); Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Comments: KAP123 fused upstream of two FLU tags in BamHI/SalI of pBT024
Proper citation: RRID:Addgene_24048 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: rRNA 5'ETS ntds 347 to 631
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pTOPO; Vector Types:Bacterial Cloning - TOPO; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15489292
Proper citation: RRID:Addgene_23994 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: NAB2
Vector Backbone Description: Backbone Size:9000; Vector Backbone:pYX242; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Comments: NLS of NAB2 (bp 601-750) inserted in EcoRI/BamHI, eGFP inserted downstream in BamHI/HindIII and a single PrA repeat inserted further downstream in HindIII/SalI of pYX242.
PrA motif sequence downstream of GFP:
GCTCAACAAAATGCTTTTTATCAAGTCTTAAATATGCCTAACTTAAATGCTGATCAACGCAATGGTTTTATCCAAAGCCTTAAAGATGATCCAAGCCAAAGTGCTAACGTTTTAGGTGAAGCTCAAAAACTTAATGACTCTCAAGCTCCAAAAGCTGATGCGCAACAAAATAAC
Proper citation: RRID:Addgene_24043 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: PHO4
Vector Backbone Description: Backbone Size:9000; Vector Backbone:pYX242; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Comments: NLS of PHO4 (bp 421-588) inserted in EcoRI/BamHI, eGFP inserted downstream in BamHI/HindIII and a single PrA repeat inserted further downstream in HindIII/SalI of pYX242.
PrA motif sequence downstream of GFP:
GCTCAACAAAATGCTTTTTATCAAGTCTTAAATATGCCTAACTTAAATGCTGATCAACGCAATGGTTTTATCCAAAGCCTTAAAGATGATCCAAGCCAAAGTGCTAACGTTTTAGGTGAAGCTCAAAAACTTAATGACTCTCAAGCTCCAAAAGCTGATGCGCAACAAAATAAC
Proper citation: RRID:Addgene_24044 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: KAP95
Vector Backbone Description: Backbone Marker:Rosemary Williams (Rout Lab); Backbone Size:7100; Vector Backbone:pYEX-U (modified pYEX-BX); Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Comments: KAP95 fused upstream of two FLU tags in BamHI/SalI of pBT024
Proper citation: RRID:Addgene_24045 Copy
Species: Homo sapiens
Genetic Insert: PTPRN
Vector Backbone Description: Backbone Size:5051; Vector Backbone:pFC14K; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_24057 Copy
Species: E. coli
Genetic Insert: LacZ
Vector Backbone Description: Backbone Size:5600; Vector Backbone:pRSV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:3471759
Comments: RSV - LacZ - STOP - SV40 PolyA
Proper citation: RRID:Addgene_24058 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
