Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 20 showing 381 ~ 400 out of 739,718 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_21122

http://www.addgene.org/21122

Species: Homo sapiens
Genetic Insert: miR-29b-1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17204650

Proper citation: RRID:Addgene_21122 Copy   


  • RRID:Addgene_21121

    This resource has 1+ mentions.

http://www.addgene.org/21121

Species: Homo sapiens
Genetic Insert: miR-29b-1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17204650

Proper citation: RRID:Addgene_21121 Copy   


  • RRID:Addgene_21087

http://www.addgene.org/21087

Species: Homo sapiens
Genetic Insert: HOXB4
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:3000; Vector Backbone:pSP65; Vector Types:In vitro T/T; Bacterial Resistance:Ampicillin
Defining Citation: PMID:8600458
Comments: PBX interaction mutant Please note that though the author's map suggests the insert is FLAG-tagged, Addgene was unable to confirm the presence of the FLAG.

Proper citation: RRID:Addgene_21087 Copy   


  • RRID:Addgene_21005

http://www.addgene.org/21005

Species: Mus musculus
Genetic Insert: HOXD8
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4076; Vector Backbone:pSG5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_21005 Copy   


  • RRID:Addgene_21126

    This resource has 1+ mentions.

http://www.addgene.org/21126

Species: Homo sapiens
Genetic Insert: Yes-kinase associated protein
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP C3; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19371381

Proper citation: RRID:Addgene_21126 Copy   


  • RRID:Addgene_21004

http://www.addgene.org/21004

Species: Mus musculus
Genetic Insert: HOXD4
Vector Backbone Description: Backbone Marker:Stratagene (originally); Backbone Size:4000; Vector Backbone:pBluescript derivative; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_21004 Copy   


http://www.addgene.org/21124

Species: Homo sapiens
Genetic Insert: Yes-kinase associated protein
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5300; Vector Backbone:pcDNA4/HisMaxB; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19371381

Proper citation: RRID:Addgene_21124 Copy   


  • RRID:Addgene_21081

http://www.addgene.org/21081

Species: Drosophila melanogaster
Genetic Insert: Gr64a
Vector Backbone Description: Backbone Size:11000; Vector Backbone:pUAST; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17715294

Proper citation: RRID:Addgene_21081 Copy   


  • RRID:Addgene_21053

    This resource has 1+ mentions.

http://www.addgene.org/21053

Species: Homo sapiens
Genetic Insert: von Hippel-Lindau tumor suppressor
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:7800; Vector Backbone:pESC-LEU; Vector Types:Yeast Expression, yeast/bacteria shuttle; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18756251

Proper citation: RRID:Addgene_21053 Copy   


http://www.addgene.org/21109

Species: Homo sapiens
Genetic Insert: miR-17-92 cluster
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5523; Vector Backbone:pcDNA3.1/V5-His-TOPO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15944709

Proper citation: RRID:Addgene_21109 Copy   


  • RRID:Addgene_21067

http://www.addgene.org/21067

Species: Rattus norvegicus
Genetic Insert: UIM
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4733; Vector Backbone:pECFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:18689690

Proper citation: RRID:Addgene_21067 Copy   


  • RRID:Addgene_21066

    This resource has 1+ mentions.

http://www.addgene.org/21066

Species: Rattus norvegicus
Genetic Insert: Epsin 1
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4733; Vector Backbone:pECFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:18689690

Proper citation: RRID:Addgene_21066 Copy   


http://www.addgene.org/21103

Species: Homo sapiens
Genetic Insert: RNAi against hypoxia inducible factor 1alpha
Vector Backbone Description: Backbone Size:3300; Vector Backbone:PBS/U6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19131628
Comments: HIF1α RNAi target sequence: GAGCTTGCTCATCAGTTGCCA

Proper citation: RRID:Addgene_21103 Copy   


  • RRID:Addgene_21155

    This resource has 1+ mentions.

http://www.addgene.org/21155

Species: Gallus gallus
Genetic Insert: FAK
Vector Backbone Description: Backbone Size:5169; Vector Backbone:pBABE-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_21155 Copy   


  • RRID:Addgene_21154

    This resource has 10+ mentions.

http://www.addgene.org/21154

Species: Homo sapiens
Genetic Insert: pcDNA3-HA-Sumo1
Vector Backbone Description: Vector Backbone:pcDNA3.1 HA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15117942
Comments: This plasmid does not contain the BGH polyA terminator present in the standard pcDNA3 backbone. It is not known whether the removal of the terminator affects expression.

Proper citation: RRID:Addgene_21154 Copy   


  • RRID:Addgene_21159

    This resource has 1+ mentions.

http://www.addgene.org/21159

Genetic Insert: HA-Q79-GFP
Vector Backbone Description: Backbone Size:0; Vector Backbone:PEGFP; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:12540902

Proper citation: RRID:Addgene_21159 Copy   


  • RRID:Addgene_21150

    This resource has 1+ mentions.

http://www.addgene.org/21150

Species: Homo sapiens
Genetic Insert: PcDNA3-Beclin1
Vector Backbone Description: Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16522639

Proper citation: RRID:Addgene_21150 Copy   


  • RRID:Addgene_21208

    This resource has 1+ mentions.

http://www.addgene.org/21208

Species: Homo sapiens
Genetic Insert: Mek1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2200; Vector Backbone:pENTR1A; Vector Types:Subclone vector; Bacterial Resistance:Kanamycin
Defining Citation: PMID:15342384

Proper citation: RRID:Addgene_21208 Copy   


  • RRID:Addgene_21207

    This resource has 1+ mentions.

http://www.addgene.org/21207

Species: Homo sapiens
Genetic Insert: Mek1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2200; Vector Backbone:pENTR1A; Vector Types:Subclone vector; Bacterial Resistance:Kanamycin
Defining Citation: PMID:15342384
Comments: Constitutive active protein has the following aa sequence deleted - ALQKKLEELELDEQQRKRLE, residues 31 to 51.

Proper citation: RRID:Addgene_21207 Copy   


  • RRID:Addgene_21200

http://www.addgene.org/21200

Species: Homo sapiens
Genetic Insert: Mek2
Vector Backbone Description: Backbone Size:11100; Vector Backbone:LZRS-RfA; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15342384

Proper citation: RRID:Addgene_21200 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. Neuroscience Information Framework Resources

    Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within NIF that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X