Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: E. coli
Genetic Insert: IS621 Recombinase
Vector Backbone Description: Vector Backbone:pNP561 - p15A Ori; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:38926615
Comments: Please visit https://doi.org/10.1101/2024.01.24.577089 for bioRxiv preprint.
Proper citation: RRID:Addgene_222728 Copy
Species: E. coli
Genetic Insert: IS621 Helper (WT)
Vector Backbone Description: Vector Backbone:pNP1950 - p15A Ori; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:38926615
Comments: Please visit https://doi.org/10.1101/2024.01.24.577089 for bioRxiv preprint.
Proper citation: RRID:Addgene_222732 Copy
Species: E. coli
Genetic Insert: IS621 bridge RNA
Vector Backbone Description: Vector Backbone:pNP1723 - ColE1 Ori; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:38926615
Comments: Please visit https://doi.org/10.1101/2024.01.24.577089 for bioRxiv preprint.
Proper citation: RRID:Addgene_222730 Copy
Species: E. coli
Genetic Insert: Genotype: F’[traD36 lacIq lacZ ∆M15 proA+B+] glnV (supE) thi-1 ∆(mcrB-hsdSM)5 (rK- mK- McrB-) ∆(lac-proAB) ulaD::M13
Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:38499480
Comments: Primers for validation
Pair 1: agtaaggacgcgccatgaaa + agcgaaagacagcatcggaa (Ta = 59 C, should have 2526 bp product)
Pair 2: aatcggttgaatgtcgccct + gggaaacgacgatgagcaga (Ta = 59, should have 3900 bp product)
Proper citation: RRID:Addgene_220921 Copy
Species: E. coli
Genetic Insert: AsnRS
Vector Backbone Description: Vector Backbone:pET21a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:40209036
Comments: It is best to grow cells in strains with LacIq and in media supplemented 1% glucose for genetic stability. Please visit https://doi.org/10.1101/2024.06.19.599772 for bioRxiv preprint.
Proper citation: RRID:Addgene_224363 Copy
Species: E. coli
Genetic Insert: PheRS
Vector Backbone Description: Vector Backbone:pET21a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:40209036
Comments: It is best to grow cells in strains with LacIq and in media supplemented 1% glucose for genetic stability. Please visit https://doi.org/10.1101/2024.06.19.599772 for bioRxiv preprint.
Proper citation: RRID:Addgene_224364 Copy
Species: E. coli
Genetic Insert: IF2
Vector Backbone Description: Vector Backbone:pET21a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:40209036
Comments: It is best to grow cells in strains with LacIq and in media supplemented 1% glucose for genetic stability. Please visit https://doi.org/10.1101/2024.06.19.599772 for bioRxiv preprint.
Proper citation: RRID:Addgene_224367 Copy
Species: E. coli
Genetic Insert: NDK
Vector Backbone Description: Vector Backbone:pET21a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:40209036
Comments: It is best to grow cells in strains with LacIq and in media supplemented 1% glucose for genetic stability. Please visit https://doi.org/10.1101/2024.06.19.599772 for bioRxiv preprint.
Proper citation: RRID:Addgene_224376 Copy
Species: E. coli
Genetic Insert: RRF
Vector Backbone Description: Vector Backbone:pET21a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:40209036
Comments: It is best to grow cells in strains with LacIq and in media supplemented 1% glucose for genetic stability. Please visit https://doi.org/10.1101/2024.06.19.599772 for bioRxiv preprint.
Proper citation: RRID:Addgene_224374 Copy
Species: E. coli
Genetic Insert: RF1
Vector Backbone Description: Vector Backbone:pET21a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:40209036
Comments: It is best to grow cells in strains with LacIq and in media supplemented 1% glucose for genetic stability. Please visit https://doi.org/10.1101/2024.06.19.599772 for bioRxiv preprint.
Proper citation: RRID:Addgene_224372 Copy
Species: E. coli
Genetic Insert: EF-Tu
Vector Backbone Description: Vector Backbone:pET21a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:40209036
Comments: It is best to grow cells in strains with LacIq and in media supplemented 1% glucose for genetic stability. Please visit https://doi.org/10.1101/2024.06.19.599772 for bioRxiv preprint.
Proper citation: RRID:Addgene_224370 Copy
Species: E. coli
Genetic Insert: EF-Ts
Vector Backbone Description: Vector Backbone:pET21a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:40209036
Comments: It is best to grow cells in strains with LacIq and in media supplemented 1% glucose for genetic stability. Please visit https://doi.org/10.1101/2024.06.19.599772 for bioRxiv preprint.
Proper citation: RRID:Addgene_224371 Copy
Species: E. coli
Genetic Insert: EcNR1 pUltraG ScW40 CCA trpS::ZeoR trpT::gentR dgalK lambdaRED::galK
Vector Backbone Description: Vector Backbone:n/a; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin (50 ug/mL), Gentamycin (10 ug/mL)
Defining Citation: PMID:28192410
Proper citation: RRID:Addgene_218768 Copy
Species: E. coli
Genetic Insert: pUltraG ScW40CCA BL21 trpT::gentR trpS::zeoR
Vector Backbone Description: Vector Backbone:n/a; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin (50 ug/mL), Gentamycin (10 ug/mL)
Defining Citation: PMID:34655653
Proper citation: RRID:Addgene_218769 Copy
Species: E. coli
Genetic Insert: EcTyrRS-pAAFRS-9
Vector Backbone Description: Backbone Size:4091; Vector Backbone:pEVOL-tac; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:38913984
Comments: EcY-tRNA-TAG
After the plasmids are propagated, they need to be gel purified by agarose gel because the ATM strains contain a plasmid in their genome.
Proper citation: RRID:Addgene_218767 Copy
Species: E. coli
Genetic Insert: EcWRS-h14
Vector Backbone Description: Backbone Size:4166; Vector Backbone:pEvoltac; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:28192410
Comments: EcW-tRNA-TGA
After the plasmids are propagated, they need to be gel purified by agarose gel because the ATM strains contain a plasmid in their genome.
Proper citation: RRID:Addgene_218764 Copy
Species: E. coli
Genetic Insert: speG
Vector Backbone Description: Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:38885650
Proper citation: RRID:Addgene_220478 Copy
Species: E. coli
Genetic Insert: speG
Vector Backbone Description: Vector Backbone:pTrcHis A; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38885650
Proper citation: RRID:Addgene_220473 Copy
Species: E. coli
Genetic Insert: Tir
Vector Backbone Description: Vector Backbone:pRetroX-TRE3G; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38925114
Proper citation: RRID:Addgene_221326 Copy
Species: E. Coli
Genetic Insert: Ptn5_[Tn5]
Vector Backbone Description: Vector Backbone:N/A; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Proper citation: RRID:Addgene_225785 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
