Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Organism:e. coli (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

1,738 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pNP1830
 
Resource Report
Resource Website 		RRID:Addgene_222728 IS621 Recombinase E. coli Chloramphenicol PMID:38926615 Please visit https://doi.org/10.1101/2024.01.24.577089 for bioRxiv preprint. Vector Backbone:pNP561 - p15A Ori; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol 2026-09-12 02:41:22 0
pNP2157
 
Resource Report
Resource Website 		RRID:Addgene_222732 IS621 Helper (WT) E. coli Chloramphenicol PMID:38926615 Please visit https://doi.org/10.1101/2024.01.24.577089 for bioRxiv preprint. Vector Backbone:pNP1950 - p15A Ori; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol 2026-09-12 02:41:22 0
pNP1954
 
Resource Report
Resource Website 		RRID:Addgene_222730 IS621 bridge RNA E. coli Kanamycin PMID:38926615 Please visit https://doi.org/10.1101/2024.01.24.577089 for bioRxiv preprint. Vector Backbone:pNP1723 - ColE1 Ori; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-09-12 02:41:24 0
eScaf
 
Resource Report
Resource Website 		RRID:Addgene_220921 Genotype: F’[traD36 lacIq lacZ ∆M15 proA+B+] glnV (supE) thi-1 ∆(mcrB-hsdSM)5 (rK- mK- McrB-) ∆(lac-proAB) ulaD::M13 E. coli None PMID:38499480 Primers for validation Pair 1: agtaaggacgcgccatgaaa + agcgaaagacagcatcggaa (Ta = 59 C, should have 2526 bp product) Pair 2: aatcggttgaatgtcgccct + gggaaacgacgatgagcaga (Ta = 59, should have 3900 bp product) Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None 2026-09-12 02:41:28 0
PT7lacO-His6-AsnRS
 
Resource Report
Resource Website 		RRID:Addgene_224363 AsnRS E. coli Ampicillin PMID:40209036 It is best to grow cells in strains with LacIq and in media supplemented 1% glucose for genetic stability. Please visit https://doi.org/10.1101/2024.06.19.599772 for bioRxiv preprint. Vector Backbone:pET21a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-09-12 02:41:33 0
PT7lacO-His6-PheRSa-PheRSb
 
Resource Report
Resource Website 		RRID:Addgene_224364 PheRS E. coli Ampicillin PMID:40209036 It is best to grow cells in strains with LacIq and in media supplemented 1% glucose for genetic stability. Please visit https://doi.org/10.1101/2024.06.19.599772 for bioRxiv preprint. Vector Backbone:pET21a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-09-12 02:41:33 0
PT7lacO-His6-IF2
 
Resource Report
Resource Website 		RRID:Addgene_224367 IF2 E. coli Ampicillin PMID:40209036 It is best to grow cells in strains with LacIq and in media supplemented 1% glucose for genetic stability. Please visit https://doi.org/10.1101/2024.06.19.599772 for bioRxiv preprint. Vector Backbone:pET21a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-09-12 02:41:33 0
PT7lacO-His6-NDK
 
Resource Report
Resource Website 		RRID:Addgene_224376 NDK E. coli Ampicillin PMID:40209036 It is best to grow cells in strains with LacIq and in media supplemented 1% glucose for genetic stability. Please visit https://doi.org/10.1101/2024.06.19.599772 for bioRxiv preprint. Vector Backbone:pET21a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-09-12 02:41:33 0
PT7lacO-RRF-His6
 
Resource Report
Resource Website 		RRID:Addgene_224374 RRF E. coli Ampicillin PMID:40209036 It is best to grow cells in strains with LacIq and in media supplemented 1% glucose for genetic stability. Please visit https://doi.org/10.1101/2024.06.19.599772 for bioRxiv preprint. Vector Backbone:pET21a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-09-12 02:41:33 0
PT7lacO-RF1-His6
 
Resource Report
Resource Website 		RRID:Addgene_224372 RF1 E. coli Ampicillin PMID:40209036 It is best to grow cells in strains with LacIq and in media supplemented 1% glucose for genetic stability. Please visit https://doi.org/10.1101/2024.06.19.599772 for bioRxiv preprint. Vector Backbone:pET21a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-09-12 02:41:33 0
PT7lacO-EF-Tu-His8
 
Resource Report
Resource Website 		RRID:Addgene_224370 EF-Tu E. coli Ampicillin PMID:40209036 It is best to grow cells in strains with LacIq and in media supplemented 1% glucose for genetic stability. Please visit https://doi.org/10.1101/2024.06.19.599772 for bioRxiv preprint. Vector Backbone:pET21a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-09-12 02:41:33 0
PT7lacO-EF-Ts-His6
 
Resource Report
Resource Website 		RRID:Addgene_224371 EF-Ts E. coli Ampicillin PMID:40209036 It is best to grow cells in strains with LacIq and in media supplemented 1% glucose for genetic stability. Please visit https://doi.org/10.1101/2024.06.19.599772 for bioRxiv preprint. Vector Backbone:pET21a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-09-12 02:41:33 0
ATMW1
 
Resource Report
Resource Website 		RRID:Addgene_218768 EcNR1 pUltraG ScW40 CCA trpS::ZeoR trpT::gentR dgalK lambdaRED::galK E. coli Spectinomycin (50 ug/mL), Gentamycin (10 ug/mL) PMID:28192410 Vector Backbone:n/a; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin (50 ug/mL), Gentamycin (10 ug/mL) 2026-09-12 02:41:09 0
ATMW-BL21
 
Resource Report
Resource Website 		RRID:Addgene_218769 pUltraG ScW40CCA BL21 trpT::gentR trpS::zeoR E. coli Spectinomycin (50 ug/mL), Gentamycin (10 ug/mL) PMID:34655653 Vector Backbone:n/a; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin (50 ug/mL), Gentamycin (10 ug/mL) 2026-09-12 02:41:09 0
pEVOL-tac-EcTyrRS-pAAFRS-9-lpp-tRNA_CUA^EcTyr
 
Resource Report
Resource Website 		RRID:Addgene_218767 EcTyrRS-pAAFRS-9 E. coli Chloramphenicol PMID:38913984 EcY-tRNA-TAG After the plasmids are propagated, they need to be gel purified by agarose gel because the ATM strains contain a plasmid in their genome. Backbone Size:4091; Vector Backbone:pEVOL-tac; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol Y37G, L71V, D182C, F183Y, L186C, D265R 2026-09-12 02:41:09 0
pEvoltac-EcW-TGA-h14
 
Resource Report
Resource Website 		RRID:Addgene_218764 EcWRS-h14 E. coli Chloramphenicol PMID:28192410 EcW-tRNA-TGA After the plasmids are propagated, they need to be gel purified by agarose gel because the ATM strains contain a plasmid in their genome. Backbone Size:4166; Vector Backbone:pEvoltac; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol S8A, V144G, V146C 2026-09-12 02:41:09 0
pET28a_speG_Nterm_His
 
Resource Report
Resource Website 		RRID:Addgene_220478 speG E. coli Kanamycin PMID:38885650 Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin none 2026-09-12 02:41:15 0
pTrcHis_VectorA_short_speG_genomic
 
Resource Report
Resource Website 		RRID:Addgene_220473 speG E. coli Ampicillin PMID:38885650 Vector Backbone:pTrcHis A; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin none 2026-09-12 02:41:15 0
pRetroX-TRE3G-Tir
 
Resource Report
Resource Website 		RRID:Addgene_221326 Tir E. coli Ampicillin PMID:38925114 Vector Backbone:pRetroX-TRE3G; Vector Types:Retroviral; Bacterial Resistance:Ampicillin 2026-09-12 02:41:19 0
pGLU_103
 
Resource Report
Resource Website 		RRID:Addgene_225785 Ptn5_[Tn5] E. Coli Chloramphenicol Vector Backbone:N/A; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol N/A 2026-09-12 02:41:51 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. Neuroscience Information Framework Resources

    Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web.  We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.

Recent News Entries

Recommendations for repositories and scientific gateways from a neuroscience perspective

NEURON course at the CNS meeting

Neuron Course this year has just been announced!

Contact Us

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch