Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pNP1830 Resource Report Resource Website |
RRID:Addgene_222728 | IS621 Recombinase | E. coli | Chloramphenicol | PMID:38926615 | Please visit https://doi.org/10.1101/2024.01.24.577089 for bioRxiv preprint. | Vector Backbone:pNP561 - p15A Ori; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol | 2026-09-12 02:41:22 | 0 | |
|
pNP2157 Resource Report Resource Website |
RRID:Addgene_222732 | IS621 Helper (WT) | E. coli | Chloramphenicol | PMID:38926615 | Please visit https://doi.org/10.1101/2024.01.24.577089 for bioRxiv preprint. | Vector Backbone:pNP1950 - p15A Ori; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol | 2026-09-12 02:41:22 | 0 | |
|
pNP1954 Resource Report Resource Website |
RRID:Addgene_222730 | IS621 bridge RNA | E. coli | Kanamycin | PMID:38926615 | Please visit https://doi.org/10.1101/2024.01.24.577089 for bioRxiv preprint. | Vector Backbone:pNP1723 - ColE1 Ori; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-09-12 02:41:24 | 0 | |
|
eScaf Resource Report Resource Website |
RRID:Addgene_220921 | Genotype: F’[traD36 lacIq lacZ ∆M15 proA+B+] glnV (supE) thi-1 ∆(mcrB-hsdSM)5 (rK- mK- McrB-) ∆(lac-proAB) ulaD::M13 | E. coli | None | PMID:38499480 | Primers for validation Pair 1: agtaaggacgcgccatgaaa + agcgaaagacagcatcggaa (Ta = 59 C, should have 2526 bp product) Pair 2: aatcggttgaatgtcgccct + gggaaacgacgatgagcaga (Ta = 59, should have 3900 bp product) | Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None | 2026-09-12 02:41:28 | 0 | |
|
PT7lacO-His6-AsnRS Resource Report Resource Website |
RRID:Addgene_224363 | AsnRS | E. coli | Ampicillin | PMID:40209036 | It is best to grow cells in strains with LacIq and in media supplemented 1% glucose for genetic stability. Please visit https://doi.org/10.1101/2024.06.19.599772 for bioRxiv preprint. | Vector Backbone:pET21a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-09-12 02:41:33 | 0 | |
|
PT7lacO-His6-PheRSa-PheRSb Resource Report Resource Website |
RRID:Addgene_224364 | PheRS | E. coli | Ampicillin | PMID:40209036 | It is best to grow cells in strains with LacIq and in media supplemented 1% glucose for genetic stability. Please visit https://doi.org/10.1101/2024.06.19.599772 for bioRxiv preprint. | Vector Backbone:pET21a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-09-12 02:41:33 | 0 | |
|
PT7lacO-His6-IF2 Resource Report Resource Website |
RRID:Addgene_224367 | IF2 | E. coli | Ampicillin | PMID:40209036 | It is best to grow cells in strains with LacIq and in media supplemented 1% glucose for genetic stability. Please visit https://doi.org/10.1101/2024.06.19.599772 for bioRxiv preprint. | Vector Backbone:pET21a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-09-12 02:41:33 | 0 | |
|
PT7lacO-His6-NDK Resource Report Resource Website |
RRID:Addgene_224376 | NDK | E. coli | Ampicillin | PMID:40209036 | It is best to grow cells in strains with LacIq and in media supplemented 1% glucose for genetic stability. Please visit https://doi.org/10.1101/2024.06.19.599772 for bioRxiv preprint. | Vector Backbone:pET21a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-09-12 02:41:33 | 0 | |
|
PT7lacO-RRF-His6 Resource Report Resource Website |
RRID:Addgene_224374 | RRF | E. coli | Ampicillin | PMID:40209036 | It is best to grow cells in strains with LacIq and in media supplemented 1% glucose for genetic stability. Please visit https://doi.org/10.1101/2024.06.19.599772 for bioRxiv preprint. | Vector Backbone:pET21a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-09-12 02:41:33 | 0 | |
|
PT7lacO-RF1-His6 Resource Report Resource Website |
RRID:Addgene_224372 | RF1 | E. coli | Ampicillin | PMID:40209036 | It is best to grow cells in strains with LacIq and in media supplemented 1% glucose for genetic stability. Please visit https://doi.org/10.1101/2024.06.19.599772 for bioRxiv preprint. | Vector Backbone:pET21a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-09-12 02:41:33 | 0 | |
|
PT7lacO-EF-Tu-His8 Resource Report Resource Website |
RRID:Addgene_224370 | EF-Tu | E. coli | Ampicillin | PMID:40209036 | It is best to grow cells in strains with LacIq and in media supplemented 1% glucose for genetic stability. Please visit https://doi.org/10.1101/2024.06.19.599772 for bioRxiv preprint. | Vector Backbone:pET21a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-09-12 02:41:33 | 0 | |
|
PT7lacO-EF-Ts-His6 Resource Report Resource Website |
RRID:Addgene_224371 | EF-Ts | E. coli | Ampicillin | PMID:40209036 | It is best to grow cells in strains with LacIq and in media supplemented 1% glucose for genetic stability. Please visit https://doi.org/10.1101/2024.06.19.599772 for bioRxiv preprint. | Vector Backbone:pET21a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-09-12 02:41:33 | 0 | |
|
ATMW1 Resource Report Resource Website |
RRID:Addgene_218768 | EcNR1 pUltraG ScW40 CCA trpS::ZeoR trpT::gentR dgalK lambdaRED::galK | E. coli | Spectinomycin (50 ug/mL), Gentamycin (10 ug/mL) | PMID:28192410 | Vector Backbone:n/a; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin (50 ug/mL), Gentamycin (10 ug/mL) | 2026-09-12 02:41:09 | 0 | ||
|
ATMW-BL21 Resource Report Resource Website |
RRID:Addgene_218769 | pUltraG ScW40CCA BL21 trpT::gentR trpS::zeoR | E. coli | Spectinomycin (50 ug/mL), Gentamycin (10 ug/mL) | PMID:34655653 | Vector Backbone:n/a; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin (50 ug/mL), Gentamycin (10 ug/mL) | 2026-09-12 02:41:09 | 0 | ||
|
pEVOL-tac-EcTyrRS-pAAFRS-9-lpp-tRNA_CUA^EcTyr Resource Report Resource Website |
RRID:Addgene_218767 | EcTyrRS-pAAFRS-9 | E. coli | Chloramphenicol | PMID:38913984 | EcY-tRNA-TAG After the plasmids are propagated, they need to be gel purified by agarose gel because the ATM strains contain a plasmid in their genome. | Backbone Size:4091; Vector Backbone:pEVOL-tac; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol | Y37G, L71V, D182C, F183Y, L186C, D265R | 2026-09-12 02:41:09 | 0 |
|
pEvoltac-EcW-TGA-h14 Resource Report Resource Website |
RRID:Addgene_218764 | EcWRS-h14 | E. coli | Chloramphenicol | PMID:28192410 | EcW-tRNA-TGA After the plasmids are propagated, they need to be gel purified by agarose gel because the ATM strains contain a plasmid in their genome. | Backbone Size:4166; Vector Backbone:pEvoltac; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol | S8A, V144G, V146C | 2026-09-12 02:41:09 | 0 |
|
pET28a_speG_Nterm_His Resource Report Resource Website |
RRID:Addgene_220478 | speG | E. coli | Kanamycin | PMID:38885650 | Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | none | 2026-09-12 02:41:15 | 0 | |
|
pTrcHis_VectorA_short_speG_genomic Resource Report Resource Website |
RRID:Addgene_220473 | speG | E. coli | Ampicillin | PMID:38885650 | Vector Backbone:pTrcHis A; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | none | 2026-09-12 02:41:15 | 0 | |
|
pRetroX-TRE3G-Tir Resource Report Resource Website |
RRID:Addgene_221326 | Tir | E. coli | Ampicillin | PMID:38925114 | Vector Backbone:pRetroX-TRE3G; Vector Types:Retroviral; Bacterial Resistance:Ampicillin | 2026-09-12 02:41:19 | 0 | ||
|
pGLU_103 Resource Report Resource Website |
RRID:Addgene_225785 | Ptn5_[Tn5] | E. Coli | Chloramphenicol | Vector Backbone:N/A; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol | N/A | 2026-09-12 02:41:51 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.