Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
|||||
|---|---|---|---|---|---|---|---|---|---|---|---|
|
pcDNA3 mCitrine LIC cloning vector (6C) Resource Report Resource Website |
RRID:Addgene_30126 | Ampicillin | This is an empty LIC vector derived from pcDNA3. It adds an mCitrine gene to the C-terminus of your protein of interest. mCitrine has a excitation max of 515 nm and an emission max of 529 nm. To clone into this vector, add the following tags to your PCR primers: LIC vKoz Forward tag 5’-TACTTCCAATCCAATGCCACC(ATG) LIC vGFP Reverse tag 5’-CTCCCACTACCAATGCC Do NOT include a stop codon with your reverse primer. T4-treat PCR with dCTP. Linearize vector with SspI, then T4-treat with dGTP. Can verify the presence of insert by digesting with HindIII and XbaI. For more information, please see our website: http://qb3.berkeley.edu/qb3/macrolab/ | Backbone Size:6145; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Addgene | 2026-11-07 01:13:39 | 0 | ||||
|
Tet-O-FUW-Neurod1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_30129 | NeuroD1 | Mus musculus | Ampicillin | PMID:20107439 | Backbone Size:8373; Vector Backbone:Tet-O-FUW; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | Addgene | 2026-11-07 01:13:39 | 3 | ||
|
pcDNA3 mCerulean LIC cloning vector (6E) Resource Report Resource Website 1+ mentions |
RRID:Addgene_30128 | Ampicillin | This is an empty LIC vector derived from pcDNA3. It adds an mCerulean gene to the C-terminus of your protein of interest. mCerulean has a excitation max of 435 nm and an emission max of 477 nm. To clone into this vector, add the following tags to your PCR primers: LIC vKoz Forward tag 5’-TACTTCCAATCCAATGCCACC(ATG) LIC vGFP Reverse tag 5’-CTCCCACTACCAATGCC Do NOT include a stop codon with your reverse primer. T4-treat PCR with dCTP. Linearize vector with SspI, then T4-treat with dGTP. Can verify the presence of insert by digesting with HindIII and XbaI. For more information, please see our website: http://qb3.berkeley.edu/qb3/macrolab/ | Backbone Size:6145; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Addgene | 2026-11-07 01:13:39 | 1 | ||||
|
pETCON-E36/design_49 Resource Report Resource Website |
RRID:Addgene_30231 | Mtb ACP2 designed binding protein E36 | Designed Sequence | Ampicillin | PMID:22001016 | Backbone Size:5400; Vector Backbone:pETCON; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | Addgene | 2026-11-07 01:13:40 | 0 | ||
|
pETCON-E39/design_28 Resource Report Resource Website |
RRID:Addgene_30233 | Mtb ACP2 designed binding protein E39 | Designed Sequence | Ampicillin | PMID:22001016 | Backbone Size:5400; Vector Backbone:pETCON; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | Addgene | 2026-11-07 01:13:40 | 0 | ||
|
pFastBac LIC cloning vector (4A) Resource Report Resource Website 1+ mentions |
RRID:Addgene_30111 | Ampicillin | This plasmid is a LIC-adapted pFastBac vector. It uses the same PCR primer tags as with most of our other vectors, so one PCR product can be inserted into many different vectors at once. Add the following tags to your PCR primers: LicV1 Forward Tag TACTTCCAATCCAATGCA(ATG) LicV1 Reverse Tag TTATCCACTTCCAATGTTATTA Linearize this plasmid with SspI and gel purify the product, then T4-treat with dGTP. For the PCR product, T4-treat with dCTP. For more information, please see our website: http://qb3.berkeley.edu/macrolab/ | Backbone Size:4816; Vector Backbone:pFastBac; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | Addgene | 2026-11-07 01:13:39 | 3 | ||||
|
pETCON-E41/design_8 Resource Report Resource Website |
RRID:Addgene_30235 | Mtb ACP2 designed binding protein E41 | Designed Sequence | Ampicillin | PMID:22001016 | Backbone Size:5400; Vector Backbone:pETCON; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | Addgene | 2026-11-07 01:13:40 | 0 | ||
|
pGEX-KG-WASP-GBD Resource Report Resource Website 1+ mentions |
RRID:Addgene_30113 | WASP-GBD | Homo sapiens | Ampicillin | PMID:10950951 | Backbone Marker:ATCC; Backbone Size:5006; Vector Backbone:pGEX-KG; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | Contains the Cdc42-interacting domain of WASP (aaresidues 228-298), called WASP-GBD (for GTPase-binding domain) | Addgene | 2026-11-07 01:13:39 | 1 | |
|
pETCON-E40/design_68 Resource Report Resource Website |
RRID:Addgene_30234 | Mtb ACP2 designed binding protein E40 | Designed Sequence | Ampicillin | PMID:22001016 | Backbone Size:5400; Vector Backbone:pETCON; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | Addgene | 2026-11-07 01:13:40 | 0 | ||
|
pFastBac His6 MBP N10 TEV LIC cloning vector (4C) Resource Report Resource Website 1+ mentions |
RRID:Addgene_30116 | Ampicillin | This plasmid is a LIC-adapted pFastBac vector. It uses the same PCR primer tags as with most of our other vectors, so one PCR product can be inserted into many different vectors at once. This vector will add a His6-MBP-N10-TEV sequence to the N terminus of your protein. MBP may improve the solubility of your protein. Add the following tags to your PCR primers: LicV1 Forward Tag TACTTCCAATCCAATGCA LicV1 Reverse Tag TTATCCACTTCCAATGTTATTA Linearize this plasmid with SspI and gel purify the product, then T4-treat with dGTP. For the PCR product, T4-treat with dCTP. For more information, please see our website: http://qb3.berkeley.edu/qb3/macrolab/ | Backbone Size:5976; Vector Backbone:pFastBac; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | Addgene | 2026-11-07 01:13:39 | 8 | ||||
|
pFastBac His6 TEV LIC cloning vector (4B) Resource Report Resource Website 1+ mentions |
RRID:Addgene_30115 | Ampicillin | This plasmid is a LIC-adapted pFastBac vector. It uses the same PCR primer tags as with most of our other vectors, so one PCR product can be inserted into many different vectors at once. This vector will add a His6-TEV sequence to the N terminus of your protein. Add the following tags to your PCR primers: LicV1 Forward Tag TACTTCCAATCCAATGCA LicV1 Reverse Tag TTATCCACTTCCAATGTTATTA Linearize this plasmid with SspI and gel purify the product, then T4-treat with dGTP. For the PCR product, T4-treat with dCTP. For more information, please see our website: http://qb3.berkeley.edu/qb3/macrolab/ | Backbone Size:4812; Vector Backbone:pFastBac; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | Addgene | 2026-11-07 01:13:39 | 8 | ||||
|
pETCON-E42/design_37 Resource Report Resource Website |
RRID:Addgene_30236 | Mtb ACP2 designed binding protein E42 | Designed Sequence | Ampicillin | PMID:22001016 | Backbone Size:5400; Vector Backbone:pETCON; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | Addgene | 2026-11-07 01:13:40 | 0 | ||
|
pETCON-E47/design_20 Resource Report Resource Website |
RRID:Addgene_30239 | Mtb ACP2 designed binding protein E47 | Designed Sequence | Ampicillin | PMID:22001016 | Backbone Size:5400; Vector Backbone:pETCON; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | Addgene | 2026-11-07 01:13:40 | 0 | ||
|
pETCON-E45/design_33 Resource Report Resource Website |
RRID:Addgene_30238 | Mtb ACP2 designed binding protein E45 | Designed Sequence | Ampicillin | PMID:22001016 | Backbone Size:5400; Vector Backbone:pETCON; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | Addgene | 2026-11-07 01:13:40 | 0 | ||
|
pET MBP-FlAsH LIC cloning vector (MBP-FlAsH) Resource Report Resource Website |
RRID:Addgene_30185 | Kanamycin | This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol. This vector adds a short FlAsH tag to the C-terminus of your protein. When your protein is mixed with a biarsenical reagent (see Invitrogen's website), fluorescence will develop. This technique may be useful when a larger fusion interferes with the function of your protein. Additionally, the vector adds an MBP fusion to the N-terminus of your protein, which may help expression and solubility. To clone into this vector, add LIC tags to the 5' end of your PCR primers. Forward - 5' TACTTCCAATCCAATGCA3' Reverse - 5' CTCCCACTACCAATGCC 3' Do NOT include a stop codon with your reverse primer. Linearize the plasmid with SspI, then gel purify. When digesting the DNA with T4 polymerase, use dCTP for the insert and dGTP for your linearized vector. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/ | Backbone Size:6568; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | Addgene | 2026-11-07 01:13:39 | 0 | ||||
|
pET Biotin His6 FlAsH LIC cloning vector (H6-FlAsH) Resource Report Resource Website 1+ mentions |
RRID:Addgene_30184 | Kanamycin | This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol. This vector adds a short FlAsH tag to the C-terminus of your protein. When your protein is mixed with a biarsenical reagent (see Invitrogen's website), fluorescence will develop. This technique may be useful when a larger fusion interferes with the function of your protein. To clone into this vector, add LIC tags to the 5' end of your PCR primers. Forward - 5' TACTTCCAATCCAATGCA3' Reverse - 5' CTCCCACTACCAATGCC 3' Do NOT include a stop codon with your reverse primer. Linearize the plasmid with SspI, then gel purify. When digesting the DNA with T4 polymerase, use dCTP for the insert and dGTP for your linearized vector. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/ | Backbone Size:5380; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | Addgene | 2026-11-07 01:13:39 | 2 | ||||
|
pGEX-MK2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_30187 | MK2 | Mus musculus | Ampicillin | Backbone Marker:Amersham; Backbone Size:3200; Vector Backbone:pGEX-KG; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | Addgene | 2026-11-07 01:13:39 | 1 | |||
|
pGEX-MK4(6) Resource Report Resource Website |
RRID:Addgene_30189 | Kcna6 | Mus musculus | Ampicillin | Backbone Marker:Amersham; Backbone Size:3200; Vector Backbone:pGEX-KG; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | Addgene | 2026-11-07 01:13:39 | 0 | |||
|
HL 4202 (=HL 716 + pHL 1389) Resource Report Resource Website |
RRID:Addgene_30100 | pLtetO-1:DsrA, pLlacO-1:rpoS::gfp | E. coli | Ampicillin | PMID:21189298 | Please note that this plasmid may require a unique bacterial strain, so make sure to confirm that you can also obtain the appropriate growth strain. Please contact us at [email protected] or contact our distributors if you have any questions. | Backbone Marker:Lim Lab (modified from Rolf Lutz and Hermann Bujard, 1997); Backbone Size:2000; Vector Backbone:ColE (from pZ system) + AmpR; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin | Addgene | 2026-11-07 01:13:38 | 0 | |
|
pGEX-MK3 Resource Report Resource Website |
RRID:Addgene_30188 | Kcna3 | Mus musculus | Ampicillin | Backbone Marker:Amersham; Backbone Size:3200; Vector Backbone:pGEX-KG; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | Addgene | 2026-11-07 01:13:39 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
