Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Vector Backbone Description: Backbone Size:6145; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: This is an empty LIC vector derived from pcDNA3. It adds an mCitrine gene to the C-terminus of your protein of interest.
mCitrine has a excitation max of 515 nm and an emission max of 529 nm.
To clone into this vector, add the following tags to your PCR primers:
LIC vKoz Forward tag 5’-TACTTCCAATCCAATGCCACC(ATG)
LIC vGFP Reverse tag 5’-CTCCCACTACCAATGCC
Do NOT include a stop codon with your reverse primer.
T4-treat PCR with dCTP. Linearize vector with SspI, then T4-treat with dGTP. Can verify the presence of insert by digesting with HindIII and XbaI.
For more information, please see our website:
http://qb3.berkeley.edu/qb3/macrolab/
Proper citation: RRID:Addgene_30126 Copy
Species: Mus musculus
Genetic Insert: NeuroD1
Vector Backbone Description: Backbone Size:8373; Vector Backbone:Tet-O-FUW; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20107439
Proper citation: RRID:Addgene_30129 Copy
Vector Backbone Description: Backbone Size:6145; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: This is an empty LIC vector derived from pcDNA3. It adds an mCerulean gene to the C-terminus of your protein of interest.
mCerulean has a excitation max of 435 nm and an emission max of 477 nm.
To clone into this vector, add the following tags to your PCR primers:
LIC vKoz Forward tag 5’-TACTTCCAATCCAATGCCACC(ATG)
LIC vGFP Reverse tag 5’-CTCCCACTACCAATGCC
Do NOT include a stop codon with your reverse primer.
T4-treat PCR with dCTP. Linearize vector with SspI, then T4-treat with dGTP. Can verify the presence of insert by digesting with HindIII and XbaI.
For more information, please see our website:
http://qb3.berkeley.edu/qb3/macrolab/
Proper citation: RRID:Addgene_30128 Copy
Species: Designed Sequence
Genetic Insert: Mtb ACP2 designed binding protein E36
Vector Backbone Description: Backbone Size:5400; Vector Backbone:pETCON; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22001016
Proper citation: RRID:Addgene_30231 Copy
Species: Designed Sequence
Genetic Insert: Mtb ACP2 designed binding protein E39
Vector Backbone Description: Backbone Size:5400; Vector Backbone:pETCON; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22001016
Proper citation: RRID:Addgene_30233 Copy
Vector Backbone Description: Backbone Size:4816; Vector Backbone:pFastBac; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Comments: This plasmid is a LIC-adapted pFastBac vector. It uses the same PCR primer tags as with most of our other vectors, so one PCR product can be inserted into many different vectors at once.
Add the following tags to your PCR primers:
LicV1 Forward Tag TACTTCCAATCCAATGCA(ATG)
LicV1 Reverse Tag TTATCCACTTCCAATGTTATTA
Linearize this plasmid with SspI and gel purify the product, then T4-treat with dGTP. For the PCR product, T4-treat with dCTP.
For more information, please see our website:
http://qb3.berkeley.edu/macrolab/
Proper citation: RRID:Addgene_30111 Copy
Species: Designed Sequence
Genetic Insert: Mtb ACP2 designed binding protein E41
Vector Backbone Description: Backbone Size:5400; Vector Backbone:pETCON; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22001016
Proper citation: RRID:Addgene_30235 Copy
Species: Homo sapiens
Genetic Insert: WASP-GBD
Vector Backbone Description: Backbone Marker:ATCC; Backbone Size:5006; Vector Backbone:pGEX-KG; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10950951
Proper citation: RRID:Addgene_30113 Copy
Species: Designed Sequence
Genetic Insert: Mtb ACP2 designed binding protein E40
Vector Backbone Description: Backbone Size:5400; Vector Backbone:pETCON; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22001016
Proper citation: RRID:Addgene_30234 Copy
Vector Backbone Description: Backbone Size:5976; Vector Backbone:pFastBac; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Comments: This plasmid is a LIC-adapted pFastBac vector. It uses the same PCR primer tags as with most of our other vectors, so one PCR product can be inserted into many different vectors at once.
This vector will add a His6-MBP-N10-TEV sequence to the N terminus of your protein. MBP may improve the solubility of your protein.
Add the following tags to your PCR primers:
LicV1 Forward Tag TACTTCCAATCCAATGCA
LicV1 Reverse Tag TTATCCACTTCCAATGTTATTA
Linearize this plasmid with SspI and gel purify the product, then T4-treat with dGTP. For the PCR product, T4-treat with dCTP.
For more information, please see our website:
http://qb3.berkeley.edu/qb3/macrolab/
Proper citation: RRID:Addgene_30116 Copy
Vector Backbone Description: Backbone Size:4812; Vector Backbone:pFastBac; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Comments: This plasmid is a LIC-adapted pFastBac vector. It uses the same PCR primer tags as with most of our other vectors, so one PCR product can be inserted into many different vectors at once.
This vector will add a His6-TEV sequence to the N terminus of your protein.
Add the following tags to your PCR primers:
LicV1 Forward Tag TACTTCCAATCCAATGCA
LicV1 Reverse Tag TTATCCACTTCCAATGTTATTA
Linearize this plasmid with SspI and gel purify the product, then T4-treat with dGTP. For the PCR product, T4-treat with dCTP.
For more information, please see our website:
http://qb3.berkeley.edu/qb3/macrolab/
Proper citation: RRID:Addgene_30115 Copy
Species: Designed Sequence
Genetic Insert: Mtb ACP2 designed binding protein E42
Vector Backbone Description: Backbone Size:5400; Vector Backbone:pETCON; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22001016
Proper citation: RRID:Addgene_30236 Copy
Species: Designed Sequence
Genetic Insert: Mtb ACP2 designed binding protein E47
Vector Backbone Description: Backbone Size:5400; Vector Backbone:pETCON; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22001016
Proper citation: RRID:Addgene_30239 Copy
Species: Designed Sequence
Genetic Insert: Mtb ACP2 designed binding protein E45
Vector Backbone Description: Backbone Size:5400; Vector Backbone:pETCON; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22001016
Proper citation: RRID:Addgene_30238 Copy
Vector Backbone Description: Backbone Size:6568; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol.
This vector adds a short FlAsH tag to the C-terminus of your protein. When your protein is mixed with a biarsenical reagent (see Invitrogen's website), fluorescence will develop. This technique may be useful when a larger fusion interferes with the function of your protein.
Additionally, the vector adds an MBP fusion to the N-terminus of your protein, which may help expression and solubility.
To clone into this vector, add LIC tags to the 5' end of your PCR primers.
Forward - 5' TACTTCCAATCCAATGCA3'
Reverse - 5' CTCCCACTACCAATGCC 3'
Do NOT include a stop codon with your reverse primer.
Linearize the plasmid with SspI, then gel purify.
When digesting the DNA with T4 polymerase, use dCTP for the insert and dGTP for your linearized vector.
More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/
Proper citation: RRID:Addgene_30185 Copy
Vector Backbone Description: Backbone Size:5380; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol.
This vector adds a short FlAsH tag to the C-terminus of your protein. When your protein is mixed with a biarsenical reagent (see Invitrogen's website), fluorescence will develop. This technique may be useful when a larger fusion interferes with the function of your protein.
To clone into this vector, add LIC tags to the 5' end of your PCR primers.
Forward - 5' TACTTCCAATCCAATGCA3'
Reverse - 5' CTCCCACTACCAATGCC 3'
Do NOT include a stop codon with your reverse primer.
Linearize the plasmid with SspI, then gel purify.
When digesting the DNA with T4 polymerase, use dCTP for the insert and dGTP for your linearized vector.
More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/
Proper citation: RRID:Addgene_30184 Copy
Species: Mus musculus
Genetic Insert: MK2
Vector Backbone Description: Backbone Marker:Amersham; Backbone Size:3200; Vector Backbone:pGEX-KG; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_30187 Copy
Species: Mus musculus
Genetic Insert: Kcna6
Vector Backbone Description: Backbone Marker:Amersham; Backbone Size:3200; Vector Backbone:pGEX-KG; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_30189 Copy
Species: E. coli
Genetic Insert: pLtetO-1:DsrA, pLlacO-1:rpoS::gfp
Vector Backbone Description: Backbone Marker:Lim Lab (modified from Rolf Lutz and Hermann Bujard, 1997); Backbone Size:2000; Vector Backbone:ColE (from pZ system) + AmpR; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21189298
Comments: Please note that this plasmid may require a unique bacterial strain, so make sure to confirm that you can also obtain the appropriate growth strain. Please contact us at [email protected] or contact our distributors if you have any questions.
Proper citation: RRID:Addgene_30100 Copy
Species: Mus musculus
Genetic Insert: Kcna3
Vector Backbone Description: Backbone Marker:Amersham; Backbone Size:3200; Vector Backbone:pGEX-KG; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_30188 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
