Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 142 showing 2821 ~ 2840 out of 740,584 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_64811

http://www.addgene.org/64811

Species: Arabidopsis thaliana
Genetic Insert: SPL9
Vector Backbone Description: Vector Backbone:pYES-DEST52; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25448000

Proper citation: RRID:Addgene_64811 Copy   


  • RRID:Addgene_64818

http://www.addgene.org/64818

Species: Arabidopsis thaliana
Genetic Insert: CUC3
Vector Backbone Description: Vector Backbone:JW772 (pCAMBIA2300); Vector Types:; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25448000

Proper citation: RRID:Addgene_64818 Copy   


  • RRID:Addgene_64817

http://www.addgene.org/64817

Species: Arabidopsis thaliana
Genetic Insert: CUC2
Vector Backbone Description: Vector Backbone:JW771 (pCAMBIA2300); Vector Types:; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25448000

Proper citation: RRID:Addgene_64817 Copy   


http://www.addgene.org/64775

Species: Homo sapiens
Genetic Insert: FLJ10081
Vector Backbone Description: Backbone Marker:Life Technologies; Backbone Size:5070; Vector Backbone:pcDNA5FRT; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20018852

Proper citation: RRID:Addgene_64775 Copy   


  • RRID:Addgene_64774

http://www.addgene.org/64774

Species: Homo sapiens
Genetic Insert: ATF6a-AD (1-150)
Vector Backbone Description: Backbone Marker:EMD Biosciences; Backbone Size:5900; Vector Backbone:pET41s; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22577136

Proper citation: RRID:Addgene_64774 Copy   


  • RRID:Addgene_64770

    This resource has 1+ mentions.

http://www.addgene.org/64770

Species: Other
Genetic Insert: Cre-EBD78
Vector Backbone Description: Vector Backbone:pRS306; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23708297
Comments: The discrepancies between the depositor's sequence and Addgene’s sequences have no functional consequences.

Proper citation: RRID:Addgene_64770 Copy   


  • RRID:Addgene_64788

http://www.addgene.org/64788

Species: Homo sapiens
Genetic Insert: miR-34a promoter P4
Vector Backbone Description: Backbone Marker:Joshua Mendell; Backbone Size:5408; Vector Backbone:pGL3-Basic-IRES; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17540599

Proper citation: RRID:Addgene_64788 Copy   


  • RRID:Addgene_64789

http://www.addgene.org/64789

Species: Homo sapiens
Genetic Insert: miR-34a promoter P5
Vector Backbone Description: Backbone Marker:Joshua Mendell; Backbone Size:5408; Vector Backbone:pGL3-Basic-IRES; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17540599

Proper citation: RRID:Addgene_64789 Copy   


  • RRID:Addgene_64822

http://www.addgene.org/64822

Genetic Insert: GUS
Vector Backbone Description: Vector Backbone:pGreenIIS BAR; Vector Types:Plant Expression; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:25448000

Proper citation: RRID:Addgene_64822 Copy   


  • RRID:Addgene_64784

    This resource has 10+ mentions.

http://www.addgene.org/64784

Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4818; Vector Backbone:pGL3-Basic; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17540599

Proper citation: RRID:Addgene_64784 Copy   


  • RRID:Addgene_64799

    This resource has 1+ mentions.

http://www.addgene.org/64799

Species: Homo sapiens
Genetic Insert: Glutaredoxin-1
Vector Backbone Description: Backbone Marker:Qiagen; Vector Backbone:pQE-60; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18469822
Comments: Discrepancies between the QC and full sequence have no functional consequence.

Proper citation: RRID:Addgene_64799 Copy   


  • RRID:Addgene_64831

    This resource has 1+ mentions.

http://www.addgene.org/64831

Species: Mus musculus
Genetic Insert: Akt1
Vector Backbone Description: Backbone Size:8892; Vector Backbone:pLVX-IRES-tdTomato; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25856301

Proper citation: RRID:Addgene_64831 Copy   


  • RRID:Addgene_64794

    This resource has 1+ mentions.

http://www.addgene.org/64794

Species: Homo sapiens
Genetic Insert: Lin28b promoter P3
Vector Backbone Description: Backbone Marker:Joshua Mendell; Backbone Size:5408; Vector Backbone:pGL3-Basic-IRES; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19211792

Proper citation: RRID:Addgene_64794 Copy   


  • RRID:Addgene_64790

http://www.addgene.org/64790

Species: Homo sapiens
Genetic Insert: miR-34a promoter P6
Vector Backbone Description: Backbone Marker:Joshua Mendell; Backbone Size:5408; Vector Backbone:pGL3-Basic-IRES; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17540599

Proper citation: RRID:Addgene_64790 Copy   


  • RRID:Addgene_64967

    This resource has 1+ mentions.

http://www.addgene.org/64967

Genetic Insert: tnsABCD
Vector Backbone Description: Vector Backbone:unknown; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15908923

Proper citation: RRID:Addgene_64967 Copy   


  • RRID:Addgene_64969

    This resource has 1+ mentions.

http://www.addgene.org/64969

Vector Backbone Description: Backbone Marker:Herbert Schweizer; Vector Backbone:pUC18R6KT-mini-Tn7T; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:15908923
Comments: The uncut plasmid runs as a multimer (>10kb). Multimerization often does not impact plasmid function, but may reduce transformation efficiencies. If the monomer is needed, you might consider linearizing, gel extracting, re-ligating, and transforming the plasmid.

Proper citation: RRID:Addgene_64969 Copy   


http://www.addgene.org/64966

Genetic Insert: oriR6K
Vector Backbone Description: Backbone Marker:Herbert Schweizer; Vector Backbone:pUC18T-mini-Tn7T-Gm; Vector Types:Bacterial Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:15908923
Comments: Genbank Accession #AY884833

Proper citation: RRID:Addgene_64966 Copy   


http://www.addgene.org/64961

Vector Backbone Description: Backbone Marker:Herbert Schweizer; Vector Backbone:pUC18-mini-Tn7T-Gm; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol and Gentamicin
Defining Citation: PMID:15908923
Comments: GenBank Accession # AY737004

Proper citation: RRID:Addgene_64961 Copy   


  • RRID:Addgene_64973

http://www.addgene.org/64973

Species: Staphylococcus aureus ATCC 10832
Genetic Insert: sortase A
Vector Backbone Description: Backbone Marker:New England Biolabs; Backbone Size:6688; Vector Backbone:pTWIN1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22729808

Proper citation: RRID:Addgene_64973 Copy   


http://www.addgene.org/64972

Species: Homo sapiens
Genetic Insert: syndecan 2
Vector Backbone Description: Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24662262
Comments: Cloning by PCR using oligo (ccactgcttactggcatgcggcgcgcgtggatc) that links the 3' region of CMV promoter of pCDNA3 to the SDC2 signal peptide and the oligo (ctagaaggcacagtcgcagtgatctcataaaatagagacac) that links the polyadenilation site of bovine growth hormone in pcDNA3 to the 3'UTR of SDC2 (FAAF).

Proper citation: RRID:Addgene_64972 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. Neuroscience Information Framework Resources

    Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within NIF that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X