Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Facets


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

740,584 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name Proper Citation Insert Name Organism Bacterial Resistance Defining Citation Comments Vector Backbone Description Relevant Mutation Record Last Update Mentions Count
pIR196
 
Resource Report
Resource Website
RRID:Addgene_64811 SPL9 Arabidopsis thaliana Ampicillin PMID:25448000 Vector Backbone:pYES-DEST52; Vector Types:; Bacterial Resistance:Ampicillin 2026-08-29 01:08:53 0
JW777
 
Resource Report
Resource Website
RRID:Addgene_64818 CUC3 Arabidopsis thaliana Kanamycin PMID:25448000 Vector Backbone:JW772 (pCAMBIA2300); Vector Types:; Bacterial Resistance:Kanamycin 2026-08-29 01:08:45 0
JW776
 
Resource Report
Resource Website
RRID:Addgene_64817 CUC2 Arabidopsis thaliana Kanamycin PMID:25448000 Vector Backbone:JW771 (pCAMBIA2300); Vector Types:; Bacterial Resistance:Kanamycin rCUC2 2026-08-29 01:08:53 0
pcDNA5FRT/Flag-FLJ10081
 
Resource Report
Resource Website
RRID:Addgene_64775 FLJ10081 Homo sapiens Ampicillin PMID:20018852 Backbone Marker:Life Technologies; Backbone Size:5070; Vector Backbone:pcDNA5FRT; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-29 01:08:52 0
pET41s-GST-ATF6a-AD
 
Resource Report
Resource Website
RRID:Addgene_64774 ATF6a-AD (1-150) Homo sapiens Kanamycin PMID:22577136 Backbone Marker:EMD Biosciences; Backbone Size:5900; Vector Backbone:pET41s; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin C-term deletion 2026-08-29 01:08:45 0
pSS146
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_64770 Cre-EBD78 Other Ampicillin PMID:23708297 The discrepancies between the depositor's sequence and Addgene’s sequences have no functional consequences. Vector Backbone:pRS306; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-29 01:08:45 1
pGL3-IRES-miR34a-P4
 
Resource Report
Resource Website
RRID:Addgene_64788 miR-34a promoter P4 Homo sapiens Ampicillin PMID:17540599 Backbone Marker:Joshua Mendell; Backbone Size:5408; Vector Backbone:pGL3-Basic-IRES; Vector Types:Luciferase; Bacterial Resistance:Ampicillin 2026-08-29 01:08:45 0
pGL3-IRES-miR34a-P5
 
Resource Report
Resource Website
RRID:Addgene_64789 miR-34a promoter P5 Homo sapiens Ampicillin PMID:17540599 Backbone Marker:Joshua Mendell; Backbone Size:5408; Vector Backbone:pGL3-Basic-IRES; Vector Types:Luciferase; Bacterial Resistance:Ampicillin 2026-08-29 01:08:45 0
pPM180
 
Resource Report
Resource Website
RRID:Addgene_64822 GUS Spectinomycin PMID:25448000 Vector Backbone:pGreenIIS BAR; Vector Types:Plant Expression; Bacterial Resistance:Spectinomycin 2026-08-29 01:08:53 0
pGL3-Basic-IRES
 
Resource Report
Resource Website
10+ mentions
RRID:Addgene_64784 Ampicillin PMID:17540599 Backbone Marker:Promega; Backbone Size:4818; Vector Backbone:pGL3-Basic; Vector Types:Luciferase; Bacterial Resistance:Ampicillin 2026-08-29 01:08:45 11
pQE-60 Grx1-roGFP2-His
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_64799 Glutaredoxin-1 Homo sapiens Ampicillin PMID:18469822 Discrepancies between the QC and full sequence have no functional consequence. Backbone Marker:Qiagen; Vector Backbone:pQE-60; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-29 01:08:53 5
pLVX-IRES-tdTomato-FlagAkt1
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_64831 Akt1 Mus musculus Ampicillin PMID:25856301 Backbone Size:8892; Vector Backbone:pLVX-IRES-tdTomato; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-08-29 01:08:45 1
pGL3-IRES-Lin28b-P3
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_64794 Lin28b promoter P3 Homo sapiens Ampicillin PMID:19211792 Backbone Marker:Joshua Mendell; Backbone Size:5408; Vector Backbone:pGL3-Basic-IRES; Vector Types:Luciferase; Bacterial Resistance:Ampicillin 2026-08-29 01:08:45 1
pGL3-IRES-miR34a-P6
 
Resource Report
Resource Website
RRID:Addgene_64790 miR-34a promoter P6 Homo sapiens Ampicillin PMID:17540599 Backbone Marker:Joshua Mendell; Backbone Size:5408; Vector Backbone:pGL3-Basic-IRES; Vector Types:Luciferase; Bacterial Resistance:Ampicillin 2026-08-29 01:08:52 0
pTNS1
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_64967 tnsABCD Ampicillin PMID:15908923 Vector Backbone:unknown; Vector Types:; Bacterial Resistance:Ampicillin 2026-08-29 01:08:46 2
pUC18R6KT-mini-Tn7T-Km
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_64969 Ampicillin and Kanamycin PMID:15908923 The uncut plasmid runs as a multimer (>10kb). Multimerization often does not impact plasmid function, but may reduce transformation efficiencies. If the monomer is needed, you might consider linearizing, gel extracting, re-ligating, and transforming the plasmid. Backbone Marker:Herbert Schweizer; Vector Backbone:pUC18R6KT-mini-Tn7T; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin 2026-08-29 01:08:54 5
pUC18T-mini-Tn7T-Gm-REP
 
Resource Report
Resource Website
RRID:Addgene_64966 oriR6K Gentamicin PMID:15908923 Genbank Accession #AY884833 Backbone Marker:Herbert Schweizer; Vector Backbone:pUC18T-mini-Tn7T-Gm; Vector Types:Bacterial Expression; Bacterial Resistance:Gentamicin 2026-08-29 01:08:54 0
pUC18-mini-Tn7T-Gm-GW
 
Resource Report
Resource Website
RRID:Addgene_64961 Chloramphenicol and Gentamicin PMID:15908923 GenBank Accession # AY737004 Backbone Marker:Herbert Schweizer; Vector Backbone:pUC18-mini-Tn7T-Gm; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol and Gentamicin 2026-08-29 01:08:54 0
pTH1-SaSrtA
 
Resource Report
Resource Website
RRID:Addgene_64973 sortase A Staphylococcus aureus ATCC 10832 Ampicillin PMID:22729808 Backbone Marker:New England Biolabs; Backbone Size:6688; Vector Backbone:pTWIN1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin deleted amino acids 1-59 2026-08-29 01:08:46 0
human syndecan 2 FAAF
 
Resource Report
Resource Website
RRID:Addgene_64972 syndecan 2 Homo sapiens Ampicillin PMID:24662262 Cloning by PCR using oligo (ccactgcttactggcatgcggcgcgcgtggatc) that links the 3' region of CMV promoter of pCDNA3 to the SDC2 signal peptide and the oligo (ctagaaggcacagtcgcagtgatctcataaaatagagacac) that links the polyadenilation site of bovine growth hormone in pcDNA3 to the 3'UTR of SDC2 (FAAF). Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Y179F, S187A, S188A, Y191F 2026-08-29 01:08:54 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X
  1. Neuroscience Information Framework Resources

    Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.