Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pIR196 Resource Report Resource Website |
RRID:Addgene_64811 | SPL9 | Arabidopsis thaliana | Ampicillin | PMID:25448000 | Vector Backbone:pYES-DEST52; Vector Types:; Bacterial Resistance:Ampicillin | 2026-08-29 01:08:53 | 0 | ||
|
JW777 Resource Report Resource Website |
RRID:Addgene_64818 | CUC3 | Arabidopsis thaliana | Kanamycin | PMID:25448000 | Vector Backbone:JW772 (pCAMBIA2300); Vector Types:; Bacterial Resistance:Kanamycin | 2026-08-29 01:08:45 | 0 | ||
|
JW776 Resource Report Resource Website |
RRID:Addgene_64817 | CUC2 | Arabidopsis thaliana | Kanamycin | PMID:25448000 | Vector Backbone:JW771 (pCAMBIA2300); Vector Types:; Bacterial Resistance:Kanamycin | rCUC2 | 2026-08-29 01:08:53 | 0 | |
|
pcDNA5FRT/Flag-FLJ10081 Resource Report Resource Website |
RRID:Addgene_64775 | FLJ10081 | Homo sapiens | Ampicillin | PMID:20018852 | Backbone Marker:Life Technologies; Backbone Size:5070; Vector Backbone:pcDNA5FRT; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:08:52 | 0 | ||
|
pET41s-GST-ATF6a-AD Resource Report Resource Website |
RRID:Addgene_64774 | ATF6a-AD (1-150) | Homo sapiens | Kanamycin | PMID:22577136 | Backbone Marker:EMD Biosciences; Backbone Size:5900; Vector Backbone:pET41s; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | C-term deletion | 2026-08-29 01:08:45 | 0 | |
|
pSS146 Resource Report Resource Website 1+ mentions |
RRID:Addgene_64770 | Cre-EBD78 | Other | Ampicillin | PMID:23708297 | The discrepancies between the depositor's sequence and Addgene’s sequences have no functional consequences. | Vector Backbone:pRS306; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:08:45 | 1 | |
|
pGL3-IRES-miR34a-P4 Resource Report Resource Website |
RRID:Addgene_64788 | miR-34a promoter P4 | Homo sapiens | Ampicillin | PMID:17540599 | Backbone Marker:Joshua Mendell; Backbone Size:5408; Vector Backbone:pGL3-Basic-IRES; Vector Types:Luciferase; Bacterial Resistance:Ampicillin | 2026-08-29 01:08:45 | 0 | ||
|
pGL3-IRES-miR34a-P5 Resource Report Resource Website |
RRID:Addgene_64789 | miR-34a promoter P5 | Homo sapiens | Ampicillin | PMID:17540599 | Backbone Marker:Joshua Mendell; Backbone Size:5408; Vector Backbone:pGL3-Basic-IRES; Vector Types:Luciferase; Bacterial Resistance:Ampicillin | 2026-08-29 01:08:45 | 0 | ||
|
pPM180 Resource Report Resource Website |
RRID:Addgene_64822 | GUS | Spectinomycin | PMID:25448000 | Vector Backbone:pGreenIIS BAR; Vector Types:Plant Expression; Bacterial Resistance:Spectinomycin | 2026-08-29 01:08:53 | 0 | |||
|
pGL3-Basic-IRES Resource Report Resource Website 10+ mentions |
RRID:Addgene_64784 | Ampicillin | PMID:17540599 | Backbone Marker:Promega; Backbone Size:4818; Vector Backbone:pGL3-Basic; Vector Types:Luciferase; Bacterial Resistance:Ampicillin | 2026-08-29 01:08:45 | 11 | ||||
|
pQE-60 Grx1-roGFP2-His Resource Report Resource Website 1+ mentions |
RRID:Addgene_64799 | Glutaredoxin-1 | Homo sapiens | Ampicillin | PMID:18469822 | Discrepancies between the QC and full sequence have no functional consequence. | Backbone Marker:Qiagen; Vector Backbone:pQE-60; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:08:53 | 5 | |
|
pLVX-IRES-tdTomato-FlagAkt1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_64831 | Akt1 | Mus musculus | Ampicillin | PMID:25856301 | Backbone Size:8892; Vector Backbone:pLVX-IRES-tdTomato; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-29 01:08:45 | 1 | ||
|
pGL3-IRES-Lin28b-P3 Resource Report Resource Website 1+ mentions |
RRID:Addgene_64794 | Lin28b promoter P3 | Homo sapiens | Ampicillin | PMID:19211792 | Backbone Marker:Joshua Mendell; Backbone Size:5408; Vector Backbone:pGL3-Basic-IRES; Vector Types:Luciferase; Bacterial Resistance:Ampicillin | 2026-08-29 01:08:45 | 1 | ||
|
pGL3-IRES-miR34a-P6 Resource Report Resource Website |
RRID:Addgene_64790 | miR-34a promoter P6 | Homo sapiens | Ampicillin | PMID:17540599 | Backbone Marker:Joshua Mendell; Backbone Size:5408; Vector Backbone:pGL3-Basic-IRES; Vector Types:Luciferase; Bacterial Resistance:Ampicillin | 2026-08-29 01:08:52 | 0 | ||
|
pTNS1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_64967 | tnsABCD | Ampicillin | PMID:15908923 | Vector Backbone:unknown; Vector Types:; Bacterial Resistance:Ampicillin | 2026-08-29 01:08:46 | 2 | |||
|
pUC18R6KT-mini-Tn7T-Km Resource Report Resource Website 1+ mentions |
RRID:Addgene_64969 | Ampicillin and Kanamycin | PMID:15908923 | The uncut plasmid runs as a multimer (>10kb). Multimerization often does not impact plasmid function, but may reduce transformation efficiencies. If the monomer is needed, you might consider linearizing, gel extracting, re-ligating, and transforming the plasmid. | Backbone Marker:Herbert Schweizer; Vector Backbone:pUC18R6KT-mini-Tn7T; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-29 01:08:54 | 5 | |||
|
pUC18T-mini-Tn7T-Gm-REP Resource Report Resource Website |
RRID:Addgene_64966 | oriR6K | Gentamicin | PMID:15908923 | Genbank Accession #AY884833 | Backbone Marker:Herbert Schweizer; Vector Backbone:pUC18T-mini-Tn7T-Gm; Vector Types:Bacterial Expression; Bacterial Resistance:Gentamicin | 2026-08-29 01:08:54 | 0 | ||
|
pUC18-mini-Tn7T-Gm-GW Resource Report Resource Website |
RRID:Addgene_64961 | Chloramphenicol and Gentamicin | PMID:15908923 | GenBank Accession # AY737004 | Backbone Marker:Herbert Schweizer; Vector Backbone:pUC18-mini-Tn7T-Gm; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol and Gentamicin | 2026-08-29 01:08:54 | 0 | |||
|
pTH1-SaSrtA Resource Report Resource Website |
RRID:Addgene_64973 | sortase A | Staphylococcus aureus ATCC 10832 | Ampicillin | PMID:22729808 | Backbone Marker:New England Biolabs; Backbone Size:6688; Vector Backbone:pTWIN1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | deleted amino acids 1-59 | 2026-08-29 01:08:46 | 0 | |
|
human syndecan 2 FAAF Resource Report Resource Website |
RRID:Addgene_64972 | syndecan 2 | Homo sapiens | Ampicillin | PMID:24662262 | Cloning by PCR using oligo (ccactgcttactggcatgcggcgcgcgtggatc) that links the 3' region of CMV promoter of pCDNA3 to the SDC2 signal peptide and the oligo (ctagaaggcacagtcgcagtgatctcataaaatagagacac) that links the polyadenilation site of bovine growth hormone in pcDNA3 to the 3'UTR of SDC2 (FAAF). | Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Y179F, S187A, S188A, Y191F | 2026-08-29 01:08:54 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.