Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Arabidopsis thaliana
Genetic Insert: SPL9
Vector Backbone Description: Vector Backbone:pYES-DEST52; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25448000
Proper citation: RRID:Addgene_64811 Copy
Species: Arabidopsis thaliana
Genetic Insert: CUC3
Vector Backbone Description: Vector Backbone:JW772 (pCAMBIA2300); Vector Types:; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25448000
Proper citation: RRID:Addgene_64818 Copy
Species: Arabidopsis thaliana
Genetic Insert: CUC2
Vector Backbone Description: Vector Backbone:JW771 (pCAMBIA2300); Vector Types:; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25448000
Proper citation: RRID:Addgene_64817 Copy
Species: Homo sapiens
Genetic Insert: FLJ10081
Vector Backbone Description: Backbone Marker:Life Technologies; Backbone Size:5070; Vector Backbone:pcDNA5FRT; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20018852
Proper citation: RRID:Addgene_64775 Copy
Species: Homo sapiens
Genetic Insert: ATF6a-AD (1-150)
Vector Backbone Description: Backbone Marker:EMD Biosciences; Backbone Size:5900; Vector Backbone:pET41s; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22577136
Proper citation: RRID:Addgene_64774 Copy
Species: Other
Genetic Insert: Cre-EBD78
Vector Backbone Description: Vector Backbone:pRS306; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23708297
Comments: The discrepancies between the depositor's sequence and Addgene’s sequences have no functional consequences.
Proper citation: RRID:Addgene_64770 Copy
Species: Homo sapiens
Genetic Insert: miR-34a promoter P4
Vector Backbone Description: Backbone Marker:Joshua Mendell; Backbone Size:5408; Vector Backbone:pGL3-Basic-IRES; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17540599
Proper citation: RRID:Addgene_64788 Copy
Species: Homo sapiens
Genetic Insert: miR-34a promoter P5
Vector Backbone Description: Backbone Marker:Joshua Mendell; Backbone Size:5408; Vector Backbone:pGL3-Basic-IRES; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17540599
Proper citation: RRID:Addgene_64789 Copy
Genetic Insert: GUS
Vector Backbone Description: Vector Backbone:pGreenIIS BAR; Vector Types:Plant Expression; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:25448000
Proper citation: RRID:Addgene_64822 Copy
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4818; Vector Backbone:pGL3-Basic; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17540599
Proper citation: RRID:Addgene_64784 Copy
Species: Homo sapiens
Genetic Insert: Glutaredoxin-1
Vector Backbone Description: Backbone Marker:Qiagen; Vector Backbone:pQE-60; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18469822
Comments: Discrepancies between the QC and full sequence have no functional consequence.
Proper citation: RRID:Addgene_64799 Copy
Species: Mus musculus
Genetic Insert: Akt1
Vector Backbone Description: Backbone Size:8892; Vector Backbone:pLVX-IRES-tdTomato; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25856301
Proper citation: RRID:Addgene_64831 Copy
Species: Homo sapiens
Genetic Insert: Lin28b promoter P3
Vector Backbone Description: Backbone Marker:Joshua Mendell; Backbone Size:5408; Vector Backbone:pGL3-Basic-IRES; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19211792
Proper citation: RRID:Addgene_64794 Copy
Species: Homo sapiens
Genetic Insert: miR-34a promoter P6
Vector Backbone Description: Backbone Marker:Joshua Mendell; Backbone Size:5408; Vector Backbone:pGL3-Basic-IRES; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17540599
Proper citation: RRID:Addgene_64790 Copy
Genetic Insert: tnsABCD
Vector Backbone Description: Vector Backbone:unknown; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15908923
Proper citation: RRID:Addgene_64967 Copy
Vector Backbone Description: Backbone Marker:Herbert Schweizer; Vector Backbone:pUC18R6KT-mini-Tn7T; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:15908923
Comments: The uncut plasmid runs as a multimer (>10kb). Multimerization often does not impact plasmid function, but may reduce transformation efficiencies. If the monomer is needed, you might consider linearizing, gel extracting, re-ligating, and transforming the plasmid.
Proper citation: RRID:Addgene_64969 Copy
Genetic Insert: oriR6K
Vector Backbone Description: Backbone Marker:Herbert Schweizer; Vector Backbone:pUC18T-mini-Tn7T-Gm; Vector Types:Bacterial Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:15908923
Comments: Genbank Accession #AY884833
Proper citation: RRID:Addgene_64966 Copy
Vector Backbone Description: Backbone Marker:Herbert Schweizer; Vector Backbone:pUC18-mini-Tn7T-Gm; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol and Gentamicin
Defining Citation: PMID:15908923
Comments: GenBank Accession # AY737004
Proper citation: RRID:Addgene_64961 Copy
Species: Staphylococcus aureus ATCC 10832
Genetic Insert: sortase A
Vector Backbone Description: Backbone Marker:New England Biolabs; Backbone Size:6688; Vector Backbone:pTWIN1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22729808
Proper citation: RRID:Addgene_64973 Copy
Species: Homo sapiens
Genetic Insert: syndecan 2
Vector Backbone Description: Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24662262
Comments: Cloning by PCR using oligo (ccactgcttactggcatgcggcgcgcgtggatc) that links the 3' region of CMV promoter of pCDNA3 to the SDC2 signal peptide and the oligo (ctagaaggcacagtcgcagtgatctcataaaatagagacac) that links the polyadenilation site of bovine growth hormone in pcDNA3 to the 3'UTR of SDC2 (FAAF).
Proper citation: RRID:Addgene_64972 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
