Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: ER
Vector Backbone Description: Backbone Size:4750; Vector Backbone:mPlum; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Comments: . Excitation = 590; Emission = 649
Proper citation: RRID:Addgene_55966 Copy
Species: Homo sapiens
Genetic Insert: Endo
Vector Backbone Description: Backbone Size:4750; Vector Backbone:mPlum; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Comments: . Excitation = 590; Emission = 649
Proper citation: RRID:Addgene_55965 Copy
Species: Drosophila melanogaster
Genetic Insert: FOXO
Vector Backbone Description: Backbone Size:8904; Vector Backbone:pUAST; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_52982 Copy
Species: Drosophila melanogaster
Genetic Insert: FOXO
Vector Backbone Description: Backbone Size:8904; Vector Backbone:pUAST; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_52983 Copy
Species: Deinococcus radiodurans
Genetic Insert: L-IFP-F[2]
Vector Backbone Description: Backbone Marker:Addgene; Vector Backbone:pLpC; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24747815
Proper citation: RRID:Addgene_52902 Copy
Species: Homo sapiens
Genetic Insert: Reg-L-IFP-F[2]+Venus
Vector Backbone Description: Backbone Marker:Addgene; Vector Backbone:pLpC; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24747815
Proper citation: RRID:Addgene_52903 Copy
Species: Deinococcus radiodurans
Genetic Insert: L-IFP-F[1]
Vector Backbone Description: Backbone Marker:Addgene; Vector Backbone:pLpC; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24747815
Proper citation: RRID:Addgene_52901 Copy
Species: E.coli
Genetic Insert: OxyS sRNA
Vector Backbone Description: Backbone Marker:Lim lab; Vector Backbone:unknown; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21189298
Comments: The transcription of each sRNA was controlled by the pLlacO-1 promoter, which was induced by adding isopropyl-β-d-thiogalactopyranoside (IPTG) to the media. The part of the target mRNA that is necessary for sRNA regulation was fused to gfp and constitutively transcribed from the pLtetO-1 promoter without TetR in the system. GFP fluorescence provides a quantitative measure of target gene expression and sRNA activity.
Proper citation: RRID:Addgene_52989 Copy
Species: Mus musculus
Genetic Insert: Lactaherin
Vector Backbone Description: Backbone Size:3648; Vector Backbone:pPD 49.83; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22727702
Proper citation: RRID:Addgene_52987 Copy
Species: Synthetic
Genetic Insert: nls-ha-MCP-VenusN-nls-ha-PCP-VenusC
Vector Backbone Description: Backbone Size:6200; Vector Backbone:phage; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24402470
Proper citation: RRID:Addgene_52985 Copy
Vector Backbone Description: Backbone Size:3506; Vector Backbone:pSLfa; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_52908 Copy
Species: Drosophila pseudoobscura
Genetic Insert: Drosophila pseudoobscura hsp82 promoter
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4786; Vector Backbone:pGL3; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23549343
Proper citation: RRID:Addgene_52909 Copy
Species: Deinococcus radiodurans
Genetic Insert: Zipp.-L-IFP-F[2]+Venus
Vector Backbone Description: Backbone Marker:Addgene; Vector Backbone:pLpC; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24747815
Proper citation: RRID:Addgene_52906 Copy
Species: Deinococcus radiodurans
Genetic Insert: Zipp.-L-IFP-F[1]+Plum
Vector Backbone Description: Backbone Marker:Addgene; Vector Backbone:pLpC; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24747815
Proper citation: RRID:Addgene_52907 Copy
Vector Backbone Description: Backbone Size:5935; Vector Backbone:pMos3xP3DsRED; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20456509
Comments: attP site is gtagtgccccaactggggtaacctttgagttctctcagttgggggcgtag
Proper citation: RRID:Addgene_52904 Copy
Species: Homo sapiens
Genetic Insert: Cat-L-IFP-F[1]+Plum
Vector Backbone Description: Backbone Marker:Addgene; Vector Backbone:pLpC; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24747815
Proper citation: RRID:Addgene_52905 Copy
Species: E.coli
Genetic Insert: RhyB sRNA
Vector Backbone Description: Backbone Marker:Lim lab; Vector Backbone:unknown; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21189298
Proper citation: RRID:Addgene_52993 Copy
Species: E.coli
Genetic Insert: OxyS sRNA
Vector Backbone Description: Backbone Marker:Lim lab; Vector Backbone:unknown; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21189298
Comments: The pLlacO-1 promoter is induced by adding isopropyl-β-d-thiogalactopyranoside (IPTG) to the media. The LtetO-1 promoter is constitutively transcribed without TetR in the system. The part of the target mRNA that is necessary for sRNA regulation was fused to gfp or mCherry.
Proper citation: RRID:Addgene_52991 Copy
Species: E.coli
Genetic Insert: DsrA sRNA
Vector Backbone Description: Backbone Marker:Lim lab; Vector Backbone:unknown; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21189298
Proper citation: RRID:Addgene_52992 Copy
Species: E.coli
Genetic Insert: MicC sRNA
Vector Backbone Description: Backbone Marker:Lim lab; Vector Backbone:unknown; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21189298
Comments: The pLlacO-1 promoter is induced by adding isopropyl-β-d-thiogalactopyranoside (IPTG) to the media. The LtetO-1 promoter is constitutively transcribed without TetR in the system. The part of the target mRNA that is necessary for sRNA regulation was fused to gfp or mCherry.
Proper citation: RRID:Addgene_52990 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
