Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Saccharomyces cerevisiae
Genetic Insert: SUP35 gene encoding translation release factor 3 from S. cerevisiae
Vector Backbone Description: Backbone Marker:GE Healthcare; Backbone Size:4954; Vector Backbone:pGEX-6P-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_29744 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: SUP45 gene encoding translation release factor 1 from S. cerevisiae
Vector Backbone Description: Backbone Marker:GE Healthcare; Backbone Size:4968; Vector Backbone:pGEX-6P-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_29743 Copy
Species: Mus musculus
Genetic Insert: integrin beta 1
Vector Backbone Description: Backbone Size:1380; Vector Backbone:pCAX; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18160654
Proper citation: RRID:Addgene_30153 Copy
Genetic Insert: APLP1 shRNA 2
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2700; Vector Backbone:pENTR; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:18573216
Comments: cagattaatgaggtgatgc
ok
Proper citation: RRID:Addgene_30157 Copy
Species: Homo sapiens
Genetic Insert: Amyloid Precursor Like Protein 1
Vector Backbone Description: Backbone Size:1380; Vector Backbone:pCAX; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18160654
Proper citation: RRID:Addgene_30141 Copy
Species: Homo sapiens
Genetic Insert: Amyloid Precursor Protein
Vector Backbone Description: Backbone Size:1380; Vector Backbone:pCAX; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18160654
Proper citation: RRID:Addgene_30143 Copy
Species: Homo sapiens
Genetic Insert: human APP 695 Swedish/Indiana mutation
Vector Backbone Description: Backbone Size:4731; Vector Backbone:pCAX; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18160654
Proper citation: RRID:Addgene_30145 Copy
Species: Homo sapiens
Genetic Insert: Amyloid Precursor Protein
Vector Backbone Description: Backbone Size:1380; Vector Backbone:pCAX; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18160654
Proper citation: RRID:Addgene_30144 Copy
Species: Homo sapiens
Genetic Insert: Amyloid Precursor Protein - soluble
Vector Backbone Description: Backbone Size:1380; Vector Backbone:pCAX; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18160654
Proper citation: RRID:Addgene_30147 Copy
Species: Homo sapiens
Genetic Insert: APP C99
Vector Backbone Description: Backbone Size:4731; Vector Backbone:pCAX; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18160654
Proper citation: RRID:Addgene_30146 Copy
Species: Homo sapiens
Genetic Insert: Amyloid Precursor Protein - soluble
Vector Backbone Description: Backbone Size:1380; Vector Backbone:pCAX; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18160654
Proper citation: RRID:Addgene_30149 Copy
Species: E. coli
Genetic Insert: pLlacO-1:hfq, pLtetO-1:ompC::gfp
Vector Backbone Description: Backbone Marker:Lim Lab (modified from Rolf Lutz and Hermann Bujard, 1997); Backbone Size:2000; Vector Backbone:ColE (from pZ system) + AmpR; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21189298
Comments: Please note that this plasmid may require a unique bacterial strain, so make sure to confirm that you can also obtain the appropriate growth strain. Please contact us at [email protected] or contact our distributors if you have any questions.
Proper citation: RRID:Addgene_30097 Copy
Genetic Insert: APP shRNA 1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2700; Vector Backbone:pENTR; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:18160654
Comments: gcacatgaatgtgcagaatgg
Proper citation: RRID:Addgene_30134 Copy
Species: Thermotoga maritima
Genetic Insert: ylqF
Vector Backbone Description: Backbone Size:5400; Vector Backbone:pET21a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18536017
Proper citation: RRID:Addgene_30133 Copy
Species: Homo sapiens
Genetic Insert: Amyloid Precursor Protein
Vector Backbone Description: Vector Backbone:pCAX; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18160654
Proper citation: RRID:Addgene_30138 Copy
Species: Homo sapiens
Genetic Insert: Amyloid Precursor Protein
Vector Backbone Description: Backbone Size:1380; Vector Backbone:pCAX; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18160654
Proper citation: RRID:Addgene_30137 Copy
Vector Backbone Description: Backbone Size:5279; Vector Backbone:pFastBac Dual; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Comments: This plasmid is a LIC-adapted pFastBac Dual vector. It uses the same PCR primer tags as with most of our other vectors, so one PCR product can be inserted into many different vectors at once.
This vector is a dual expression vector, and your 2 genes can be inserted in any order (check your gene for internal restriction sites, as this may dictate cloning order).
LIC site v1:
Add the following tags to your PCR primers:
LicV1 Forward Tag TACTTCCAATCCAATGCA(ATG)
LicV1 Reverse Tag TTATCCACTTCCAATGTTATTA
Linearize vector with SspI and gel purify. T4-treat vector with dGTP. For the PCR product, T4-treat with dCTP.
LIC site v2
LicV2 Forward Tag TTTAAGAAGGAGATATAGATC(ATG)
LicV2 Reverse Tag TTATGGAGTTGGGATCTTATTA
Linearize vector with EcoRV and gel purify. T4-treat vector with dCTP. For the PCR product, T4-treat with dGTP.
To sequence LIC site v1, use the following primers:
LicBac dual V1 F cctataactattccggattattcataccgtc
LicBac dual V1 R caggttcagggggaggtgtg
To sequence LIC site v2, use the following primers:
LicBac dual V2 F gtcatagcgcgggttccttcc
LicBac dual V2 R ggagtatacggacctttaattcaaccc
For more information, please see our website:
http://qb3.berkeley.edu/qb3/macrolab/
Proper citation: RRID:Addgene_30121 Copy
Vector Backbone Description: Backbone Size:6472; Vector Backbone:pFastBac Dual; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Comments: This plasmid is a LIC-adapted pFastBac Dual vector. It uses the same PCR primer tags as with most of our other vectors, so one PCR product can be inserted into many different vectors at once.
This vector is a dual expression vector, and your genes can be inserted in any order (check your gene for internal restriction sites, as this may dictate cloning order).
A gene inserted into LIC site 1 will have a His6-MBP-N10-TEV tag added to the N-terminus. A gene inserted into LIC site 2 will remain untagged.
LIC site v1:
Add the following tags to your PCR primers:
LicV1 Forward Tag TACTTCCAATCCAATGCA
LicV1 Reverse Tag TTATCCACTTCCAATGTTATTA
Linearize vector with SspI and gel purify. T4-treat vector with dGTP. For the PCR product, T4-treat with dCTP.
LIC site v2:
Add the following tags to your PCR primers:
LicV2 Forward Tag TTTAAGAAGGAGATATAGATC(ATG)
LicV2 Reverse Tag TTATGGAGTTGGGATCTTATTA
Linearize vector with EcoRV and gel purify. T4-treat vector with dCTP. For the PCR product, T4-treat with dGTP.
For more information, please see our website:
http://qb3.berkeley.edu/qb3/macrolab/
Proper citation: RRID:Addgene_30123 Copy
Species: E. coli
Genetic Insert: pLtetO-1:fhlA::mCherry, pLlacO-1:ompC::gfp
Vector Backbone Description: Backbone Marker:Lim Lab (modified from Rolf Lutz and Hermann Bujard, 1997); Backbone Size:2000; Vector Backbone:ColE (from pZ system) + AmpR; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21189298
Comments: Please note that this plasmid may require a unique bacterial strain, so make sure to confirm that you can also obtain the appropriate growth strain. Please contact us at [email protected] or contact our distributors if you have any questions.
Proper citation: RRID:Addgene_30089 Copy
Vector Backbone Description: Backbone Size:6145; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: This is an empty LIC vector derived from pcDNA3. It adds a GFP gene to the C-terminus of your protein of interest.
GFP has a excitation max of 489 nm and an emission max of 510 nm.
To clone into this vector, add the following tags to your PCR primers:
LIC vKoz Forward tag 5’-TACTTCCAATCCAATGCCACC(ATG)
LIC vGFP Reverse tag 5’-CTCCCACTACCAATGCC
Do NOT include a stop codon with your reverse primer.
T4-treat PCR with dCTP. Linearize vector with SspI, then T4-treat with dGTP. Can verify the presence of insert by digesting with HindIII and XbaI.
For more information, please see our website:
http://qb3.berkeley.edu/qb3/macrolab/
Proper citation: RRID:Addgene_30127 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
