Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: S. aureus (strain COL)
Genetic Insert: Tagatose 1,6-diphosphate aldolase
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pET21a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21192932
Proper citation: RRID:Addgene_29786 Copy
Species: E. coli
Genetic Insert: pLlacO-1:MicC-mCherry, pLtetO-1:ompC::gfp
Vector Backbone Description: Backbone Marker:Lim Lab (modified from Rolf Lutz and Hermann Bujard, 1997); Backbone Size:2000; Vector Backbone:ColE (from pZ system) + AmpR; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21189298
Comments: Please note that this plasmid may require a unique bacterial strain, so make sure to confirm that you can also obtain the appropriate growth strain. Please contact us at [email protected] or contact our distributors if you have any questions.
Proper citation: RRID:Addgene_30008 Copy
Species: Homo sapiens
Genetic Insert: TRPM1
Vector Backbone Description: Backbone Size:9615; Vector Backbone:PLKO (modified); Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21109473
Proper citation: RRID:Addgene_29782 Copy
Genetic Insert: shSCR
Vector Backbone Description: Backbone Size:9471; Vector Backbone:PLKO (modified); Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21109473
Comments: Sequence for scrambled sh is: aattctccgaacgtgtcacgtctcgagacgtgacacgttcggagaattttttt
Proper citation: RRID:Addgene_29780 Copy
Species: E. coli
Genetic Insert: pLlacO-1:DsrA-mCherry, pLtetO-1:RBS (st7) gfp
Vector Backbone Description: Backbone Marker:Lim Lab (modified from Rolf Lutz and Hermann Bujard, 1997); Backbone Size:2000; Vector Backbone:ColE (from pZ system) + AmpR; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21189298
Comments: Please note that this plasmid may require a unique bacterial strain, so make sure to confirm that you can also obtain the appropriate growth strain. Please contact us at [email protected] or contact our distributors if you have any questions.
Proper citation: RRID:Addgene_30072 Copy
Species: Homo sapiens
Genetic Insert: WDR5
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5100; Vector Backbone:pcDNA5FRT; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20018852
Proper citation: RRID:Addgene_29759 Copy
Species: Homo sapiens
Genetic Insert: Wilms tumor 1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:36686; Vector Backbone:pAd/CMV/V5-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: Please note that Addgene distributes this plasmid in DH5a, but the depositing lab maintained the plasmid in OmniMAX™ 2 T1R (Invitrogen catalogue #C8540-03)
Proper citation: RRID:Addgene_29756 Copy
Species: Homo sapiens
Genetic Insert: dosage-sensitive sex reversal, adrenal hypoplasia critical region, on chromosome X, gene 1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:36686; Vector Backbone:pAd/CMV/V5-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: Please note that Addgene distributes this plasmid in DH5a, but the depositing lab maintained the plasmid in OmniMAX 2 T1R (Invitrogen catalogue #C8540-03)
Proper citation: RRID:Addgene_29752 Copy
Vector Backbone Description: Backbone Size:7276; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol.
mCerulean has a excitation max of 435 nm and an emission max of 477 nm. A TEV-cleavable MBP will be added to the N-terminal side of your protein to enhance solubility.
To clone into this vector, add LIC tags to the 5' end of your PCR primers.
Forward - 5'TACTTCCAATCCAATGCA3'
Reverse - 5'CTCCCACTACCAATGCC 3'
Do NOT include a stop codon with your reverse primer.
Linearize the plasmid with SspI, then gel purify.
When digesting the DNA with T4 polymerase, use dCTP for the insert and dGTP for your linearized vector.
More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/
Proper citation: RRID:Addgene_29751 Copy
Species: E. coli
Genetic Insert: pLlacO-1:OxyS-mCherry, pLtetO-1:RBS (st7) gfp
Vector Backbone Description: Backbone Marker:Lim Lab (modified from Rolf Lutz and Hermann Bujard, 1997); Backbone Size:2000; Vector Backbone:ColE (from pZ system) + AmpR; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21189298
Comments: Please note that this plasmid may require a unique bacterial strain, so make sure to confirm that you can also obtain the appropriate growth strain. Please contact us at [email protected] or contact our distributors if you have any questions.
Proper citation: RRID:Addgene_30068 Copy
Species: E. coli
Genetic Insert: pLtetO-1:mCherry, pLlacO-1:sodB::gfp
Vector Backbone Description: Backbone Marker:Lim Lab (modified from Rolf Lutz and Hermann Bujard, 1997); Backbone Size:2000; Vector Backbone:ColE (from pZ system) + AmpR; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21189298
Comments: Please note that this plasmid may require a unique bacterial strain, so make sure to confirm that you can also obtain the appropriate growth strain. Please contact us at [email protected] or contact our distributors if you have any questions.
Proper citation: RRID:Addgene_30067 Copy
Species: E. coli
Genetic Insert: pLlacO-1:MicC-mCherry, pLtetO-1:RBS (st7) gfp
Vector Backbone Description: Backbone Marker:Lim Lab (modified from Rolf Lutz and Hermann Bujard, 1997); Backbone Size:2000; Vector Backbone:ColE (from pZ system) + AmpR; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21189298
Comments: Please note that this plasmid may require a unique bacterial strain, so make sure to confirm that you can also obtain the appropriate growth strain. Please contact us at [email protected] or contact our distributors if you have any questions.
Proper citation: RRID:Addgene_30060 Copy
Species: Homo sapiens
Genetic Insert: DYSF-Venus
Vector Backbone Description: Backbone Size:3984; Vector Backbone:pEGFP N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20442251
Proper citation: RRID:Addgene_29768 Copy
Genetic Insert: let-7 sponge
Vector Backbone Description: Backbone Size:6000; Vector Backbone:MSCV puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18308936
Comments: The let-7 family sponge contains six bulged sites with alternating sequences AACUAUACAAGGACUACCUCA and AACUAUACAAUGACUACCUCA. The binding sites are for a consensus sequence of all mammalian let-7 miRNAs
Proper citation: RRID:Addgene_29766 Copy
Species: Homo sapiens
Genetic Insert: MSL1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5100; Vector Backbone:pcDNA5FRT; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20018852
Comments: An A87V mutation is present, it does not effect the function of the plasmid.
Proper citation: RRID:Addgene_29762 Copy
Species: E. coli
Genetic Insert: pLtetO-1:mCherry, pLlacO-1:ompC::gfp
Vector Backbone Description: Backbone Marker:Lim Lab (modified from Rolf Lutz and Hermann Bujard, 1997); Backbone Size:2000; Vector Backbone:ColE (from pZ system) + AmpR; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21189298
Comments: Please note that this plasmid may require a unique bacterial strain, so make sure to confirm that you can also obtain the appropriate growth strain. Please contact us at [email protected] or contact our distributors if you have any questions.
Proper citation: RRID:Addgene_30051 Copy
Species: E. coli
Genetic Insert: pCon:MicC, pLlacO-1:rpoS::gfp
Vector Backbone Description: Backbone Marker:Lim Lab (modified from Rolf Lutz and Hermann Bujard, 1997); Backbone Size:2000; Vector Backbone:ColE (from pZ system) + AmpR; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21189298
Comments: Please note that this plasmid may require a unique bacterial strain, so make sure to confirm that you can also obtain the appropriate growth strain. Please contact us at [email protected] or contact our distributors if you have any questions.
Proper citation: RRID:Addgene_30048 Copy
Species: E. coli
Genetic Insert: pLtetO-1:DsrA, pCon:MicC, pLlacO-1:rpoS::gfp
Vector Backbone Description: Backbone Marker:Lim Lab (modified from Rolf Lutz and Hermann Bujard, 1997); Backbone Size:2000; Vector Backbone:ColE (from pZ system) + AmpR; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21189298
Comments: Please note that this plasmid may require a unique bacterial strain, so make sure to confirm that you can also obtain the appropriate growth strain. Please contact us at [email protected] or contact our distributors if you have any questions.
Proper citation: RRID:Addgene_30047 Copy
Vector Backbone Description: Backbone Size:7270; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol.
mOrange has a excitation max of 548 nm and an emission max of 562 nm. A TEV-cleavable MBP will be added to the N-terminal side of your protein to enhance solubility.
To clone into this vector, add LIC tags to the 5' end of your PCR primers.
Forward - 5'TACTTCCAATCCAATGCA3'
Reverse - 5'CTCCCACTACCAATGCC 3'
Do NOT include a stop codon with your reverse primer.
Linearize the plasmid with SspI, then gel purify.
When digesting the DNA with T4 polymerase, use dCTP for the insert and dGTP for your linearized vector.
More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/
Proper citation: RRID:Addgene_29748 Copy
Vector Backbone Description: Backbone Size:7270; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol.
mCherry has a excitation max of 587 nm and an emission max of 610 nm. A TEV-cleavable MBP will be added to the N-terminal side of your protein to enhance solubility.
To clone into this vector, add LIC tags to the 5' end of your PCR primers.
Forward - 5'TACTTCCAATCCAATGCA3'
Reverse - 5'CTCCCACTACCAATGCC 3'
Do NOT include a stop codon with your reverse primer.
Linearize the plasmid with SspI, then gel purify.
When digesting the DNA with T4 polymerase, use dCTP for the insert and dGTP for your linearized vector.
More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/
Proper citation: RRID:Addgene_29747 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
