Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
|||||
|---|---|---|---|---|---|---|---|---|---|---|---|
|
LacD_L165E_pET21a Resource Report Resource Website |
RRID:Addgene_29786 | Tagatose 1,6-diphosphate aldolase | S. aureus (strain COL) | Ampicillin | PMID:21192932 | Backbone Size:5000; Vector Backbone:pET21a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | L165E | Addgene | 2026-11-07 01:13:38 | 0 | |
|
HL 839 (=HL 716 + pHL 108) Resource Report Resource Website |
RRID:Addgene_30008 | pLlacO-1:MicC-mCherry, pLtetO-1:ompC::gfp | E. coli | Ampicillin | PMID:21189298 | Please note that this plasmid may require a unique bacterial strain, so make sure to confirm that you can also obtain the appropriate growth strain. Please contact us at [email protected] or contact our distributors if you have any questions. | Backbone Marker:Lim Lab (modified from Rolf Lutz and Hermann Bujard, 1997); Backbone Size:2000; Vector Backbone:ColE (from pZ system) + AmpR; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin | Addgene | 2026-11-07 01:13:38 | 0 | |
|
PLKO-mcherry-luc-puro-TRPM1 cDNA Resource Report Resource Website |
RRID:Addgene_29782 | TRPM1 | Homo sapiens | Ampicillin | PMID:21109473 | Backbone Size:9615; Vector Backbone:PLKO (modified); Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | Addgene | 2026-11-07 01:13:37 | 0 | ||
|
PLKO-mcherry-luc-puro-shSCR Resource Report Resource Website 1+ mentions |
RRID:Addgene_29780 | shSCR | Ampicillin | PMID:21109473 | Sequence for scrambled sh is: aattctccgaacgtgtcacgtctcgagacgtgacacgttcggagaattttttt | Backbone Size:9471; Vector Backbone:PLKO (modified); Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin | Addgene | 2026-11-07 01:13:37 | 2 | ||
|
HL 3375 (=HL 865 + pHL 1008) Resource Report Resource Website |
RRID:Addgene_30072 | pLlacO-1:DsrA-mCherry, pLtetO-1:RBS (st7) gfp | E. coli | Ampicillin | PMID:21189298 | Please note that this plasmid may require a unique bacterial strain, so make sure to confirm that you can also obtain the appropriate growth strain. Please contact us at [email protected] or contact our distributors if you have any questions. | Backbone Marker:Lim Lab (modified from Rolf Lutz and Hermann Bujard, 1997); Backbone Size:2000; Vector Backbone:ColE (from pZ system) + AmpR; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin | Addgene | 2026-11-07 01:13:38 | 0 | |
|
pcDNA5FRT/Flag-WDR5 Resource Report Resource Website |
RRID:Addgene_29759 | WDR5 | Homo sapiens | Ampicillin | PMID:20018852 | Backbone Marker:Invitrogen; Backbone Size:5100; Vector Backbone:pcDNA5FRT; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Addgene | 2026-11-07 01:13:37 | 0 | ||
|
pAd/WT1-IRES-nAmCyan Resource Report Resource Website 1+ mentions |
RRID:Addgene_29756 | Wilms tumor 1 | Homo sapiens | Ampicillin | Please note that Addgene distributes this plasmid in DH5a, but the depositing lab maintained the plasmid in OmniMAX™ 2 T1R (Invitrogen catalogue #C8540-03) | Backbone Marker:Invitrogen; Backbone Size:36686; Vector Backbone:pAd/CMV/V5-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | No mutations; AmCyan is nuclear localized; WT1 and nAmCyan are separated by IRES; AmCyan from Clontech | Addgene | 2026-11-07 01:13:37 | 3 | |
|
pAd/CMV/DAX1-IRES-nEGFP Resource Report Resource Website |
RRID:Addgene_29752 | dosage-sensitive sex reversal, adrenal hypoplasia critical region, on chromosome X, gene 1 | Homo sapiens | Ampicillin | Please note that Addgene distributes this plasmid in DH5a, but the depositing lab maintained the plasmid in OmniMAX 2 T1R (Invitrogen catalogue #C8540-03) | Backbone Marker:Invitrogen; Backbone Size:36686; Vector Backbone:pAd/CMV/V5-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | No mutations; Reporter is nuclear localized EGFP; DAX1 and nEGFP is separated with an IRES | Addgene | 2026-11-07 01:13:37 | 0 | |
|
pET MBP mCerulean LIC cloning vector (MBP-mCerulean) Resource Report Resource Website |
RRID:Addgene_29751 | Kanamycin | This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol. mCerulean has a excitation max of 435 nm and an emission max of 477 nm. A TEV-cleavable MBP will be added to the N-terminal side of your protein to enhance solubility. To clone into this vector, add LIC tags to the 5' end of your PCR primers. Forward - 5'TACTTCCAATCCAATGCA3' Reverse - 5'CTCCCACTACCAATGCC 3' Do NOT include a stop codon with your reverse primer. Linearize the plasmid with SspI, then gel purify. When digesting the DNA with T4 polymerase, use dCTP for the insert and dGTP for your linearized vector. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/ | Backbone Size:7276; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | Addgene | 2026-11-07 01:13:37 | 0 | ||||
|
HL 3357 (=HL 716 + pHL 1191) Resource Report Resource Website |
RRID:Addgene_30068 | pLlacO-1:OxyS-mCherry, pLtetO-1:RBS (st7) gfp | E. coli | Ampicillin | PMID:21189298 | Please note that this plasmid may require a unique bacterial strain, so make sure to confirm that you can also obtain the appropriate growth strain. Please contact us at [email protected] or contact our distributors if you have any questions. | Backbone Marker:Lim Lab (modified from Rolf Lutz and Hermann Bujard, 1997); Backbone Size:2000; Vector Backbone:ColE (from pZ system) + AmpR; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin | Addgene | 2026-11-07 01:13:38 | 0 | |
|
HL 3347 (=HL 3338 + pHL 720) Resource Report Resource Website |
RRID:Addgene_30067 | pLtetO-1:mCherry, pLlacO-1:sodB::gfp | E. coli | Ampicillin | PMID:21189298 | Please note that this plasmid may require a unique bacterial strain, so make sure to confirm that you can also obtain the appropriate growth strain. Please contact us at [email protected] or contact our distributors if you have any questions. | Backbone Marker:Lim Lab (modified from Rolf Lutz and Hermann Bujard, 1997); Backbone Size:2000; Vector Backbone:ColE (from pZ system) + AmpR; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin | Addgene | 2026-11-07 01:13:38 | 0 | |
|
HL 3327 (=HL 716 + pHL 1009) Resource Report Resource Website |
RRID:Addgene_30060 | pLlacO-1:MicC-mCherry, pLtetO-1:RBS (st7) gfp | E. coli | Ampicillin | PMID:21189298 | Please note that this plasmid may require a unique bacterial strain, so make sure to confirm that you can also obtain the appropriate growth strain. Please contact us at [email protected] or contact our distributors if you have any questions. | Backbone Marker:Lim Lab (modified from Rolf Lutz and Hermann Bujard, 1997); Backbone Size:2000; Vector Backbone:ColE (from pZ system) + AmpR; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin | Addgene | 2026-11-07 01:13:38 | 0 | |
|
DYSF-Venus Resource Report Resource Website 1+ mentions |
RRID:Addgene_29768 | DYSF-Venus | Homo sapiens | Kanamycin | PMID:20442251 | Backbone Size:3984; Vector Backbone:pEGFP N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | Addgene | 2026-11-07 01:13:37 | 4 | ||
|
MSCV puro let-7 sponge Resource Report Resource Website 1+ mentions |
RRID:Addgene_29766 | let-7 sponge | Ampicillin | PMID:18308936 | The let-7 family sponge contains six bulged sites with alternating sequences AACUAUACAAGGACUACCUCA and AACUAUACAAUGACUACCUCA. The binding sites are for a consensus sequence of all mammalian let-7 miRNAs | Backbone Size:6000; Vector Backbone:MSCV puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | Addgene | 2026-11-07 01:13:37 | 8 | ||
|
pcDNA5FRT/Flag-LOC339287(MSL1) Resource Report Resource Website |
RRID:Addgene_29762 | MSL1 | Homo sapiens | Ampicillin | PMID:20018852 | An A87V mutation is present, it does not effect the function of the plasmid. | Backbone Marker:Invitrogen; Backbone Size:5100; Vector Backbone:pcDNA5FRT; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Addgene | 2026-11-07 01:13:37 | 0 | |
|
HL 3186 (=HL 716 + pHL 282) Resource Report Resource Website |
RRID:Addgene_30051 | pLtetO-1:mCherry, pLlacO-1:ompC::gfp | E. coli | Ampicillin | PMID:21189298 | Please note that this plasmid may require a unique bacterial strain, so make sure to confirm that you can also obtain the appropriate growth strain. Please contact us at [email protected] or contact our distributors if you have any questions. | Backbone Marker:Lim Lab (modified from Rolf Lutz and Hermann Bujard, 1997); Backbone Size:2000; Vector Backbone:ColE (from pZ system) + AmpR; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin | Addgene | 2026-11-07 01:13:38 | 0 | |
|
HL 3152 (=HL 716 + pHL 1056) Resource Report Resource Website |
RRID:Addgene_30048 | pCon:MicC, pLlacO-1:rpoS::gfp | E. coli | Ampicillin | PMID:21189298 | Please note that this plasmid may require a unique bacterial strain, so make sure to confirm that you can also obtain the appropriate growth strain. Please contact us at [email protected] or contact our distributors if you have any questions. | Backbone Marker:Lim Lab (modified from Rolf Lutz and Hermann Bujard, 1997); Backbone Size:2000; Vector Backbone:ColE (from pZ system) + AmpR; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin | Addgene | 2026-11-07 01:13:38 | 0 | |
|
HL 3151 (=HL 716 + pHL 1037) Resource Report Resource Website |
RRID:Addgene_30047 | pLtetO-1:DsrA, pCon:MicC, pLlacO-1:rpoS::gfp | E. coli | Ampicillin | PMID:21189298 | Please note that this plasmid may require a unique bacterial strain, so make sure to confirm that you can also obtain the appropriate growth strain. Please contact us at [email protected] or contact our distributors if you have any questions. | Backbone Marker:Lim Lab (modified from Rolf Lutz and Hermann Bujard, 1997); Backbone Size:2000; Vector Backbone:ColE (from pZ system) + AmpR; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin | Addgene | 2026-11-07 01:13:38 | 0 | |
|
pET MBP mOrange LIC cloning vector (MBP-mOrange) Resource Report Resource Website |
RRID:Addgene_29748 | Kanamycin | This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol. mOrange has a excitation max of 548 nm and an emission max of 562 nm. A TEV-cleavable MBP will be added to the N-terminal side of your protein to enhance solubility. To clone into this vector, add LIC tags to the 5' end of your PCR primers. Forward - 5'TACTTCCAATCCAATGCA3' Reverse - 5'CTCCCACTACCAATGCC 3' Do NOT include a stop codon with your reverse primer. Linearize the plasmid with SspI, then gel purify. When digesting the DNA with T4 polymerase, use dCTP for the insert and dGTP for your linearized vector. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/ | Backbone Size:7270; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | Addgene | 2026-11-07 01:13:37 | 0 | ||||
|
pET MBP mCherry LIC cloning vector (MBP-mCherry) Resource Report Resource Website 1+ mentions |
RRID:Addgene_29747 | Kanamycin | This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol. mCherry has a excitation max of 587 nm and an emission max of 610 nm. A TEV-cleavable MBP will be added to the N-terminal side of your protein to enhance solubility. To clone into this vector, add LIC tags to the 5' end of your PCR primers. Forward - 5'TACTTCCAATCCAATGCA3' Reverse - 5'CTCCCACTACCAATGCC 3' Do NOT include a stop codon with your reverse primer. Linearize the plasmid with SspI, then gel purify. When digesting the DNA with T4 polymerase, use dCTP for the insert and dGTP for your linearized vector. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/ | Backbone Size:7270; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | Addgene | 2026-11-07 01:13:37 | 1 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
