Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Danio rerio
Genetic Insert: gRNA-fh site #1
Vector Backbone Description: Backbone Marker:Joung lab (Addgene plasmid# 42250); Backbone Size:2147; Vector Backbone:DR274; Vector Types:CRISPR, zebrafish expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23360964
Comments: Target site: GGAGCGGTACATGGCGACCG
Guide RNA sequence: TAATACGACTCACTATAGGAGCGGTACATGGCGACCGGTTTTAGAGCTAGAAATAGCAAG TTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTAAA
Proper citation: RRID:Addgene_42243 Copy
Species: Danio rerio
Genetic Insert: gRNA-rgs4
Vector Backbone Description: Backbone Marker:Joung lab (Addgene plasmid# 42250); Backbone Size:2147; Vector Backbone:DR274; Vector Types:CRISPR, zebrafish expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23360964
Comments: Target site: GGAGAAGGTGAAGGACACTG
Guide RNA sequence: TAATACGACTCACTATAGGAGAAGGTGAAGGACACTGGTTTTAGAGCTAGAAATAGCAAG TTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTAAA
Proper citation: RRID:Addgene_42246 Copy
Species: Homo sapiens
Genetic Insert: YAP1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2300; Vector Backbone:pEntr3c; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22308401
Proper citation: RRID:Addgene_42239 Copy
Species: Rattus norvegicus
Genetic Insert: β-arrestin 1 S412D
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9924018
Comments: Flag epitope-tagged truncation mutants of β-arrestin 1 were prepared by the polymerase chain reaction (PCR), incorporating an Eco RI site, minimal Kozak sequence (ACC), and initiator methionine codon into the 5' primer, and the Flag epitope sequence, stop codon, and an Xho I site into the 3' primer. PCR products were subcloned into pcDNA3. DNA sequences were confirmed by dideoxynucleotide sequencing.
Proper citation: RRID:Addgene_42196 Copy
Species: Mus musculus
Genetic Insert: Frizzled 4
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-N2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:12958364
Comments: Fz4-GFP was generated by fusing EGFP (Clontech) at its C-terminus.
Alternate plasmid names: pEGFPN2 mFz4; pEGFP-N2-Frizzled4
Proper citation: RRID:Addgene_42197 Copy
Genetic Insert: humanized S. pyogenes Cas9
Vector Backbone Description: Vector Backbone:pUC ori vector; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23287718
Comments: Alternate plasmid name: pSpCas9(BB) (PX330)
For plasmid usage, please see the associated publication (Cong et al. Science. 2013, PMID: 23287718), as well as Ran et al. Nat Protoc. 2013, PMID: 24157548.
For more information on Zhang Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/zhang/
Proper citation: RRID:Addgene_42230 Copy
Species: Synthetic
Genetic Insert: GR-GECO1.1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4100; Vector Backbone:pTorPE; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23256581
Proper citation: RRID:Addgene_42198 Copy
Species: Synthetic
Genetic Insert: Cas9
Vector Backbone Description: Backbone Marker:QB3 MacroLab; Backbone Size:6145; Vector Backbone:MacroLab 6D; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23386978
Proper citation: RRID:Addgene_42234 Copy
Genetic Insert: PSD95
Vector Backbone Description: Vector Backbone:pCS6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20155731
Proper citation: RRID:Addgene_42235 Copy
Species: Danio rerio
Genetic Insert: EGFP-Rpl10a
Vector Backbone Description: Backbone Size:6170; Vector Backbone:pT2KXIG; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23281262
Proper citation: RRID:Addgene_42236 Copy
Vector Backbone Description: Backbone Marker:Daugelat et al 2003; Backbone Size:6900; Vector Backbone:pSD26; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:33006405
Comments: Vector constructed by Dr. Arie Geerlof at EMBL-Hamburg (now at Helmholtz Zentrum München)
Proper citation: RRID:Addgene_42192 Copy
Genetic Insert: PSD95
Vector Backbone Description: Vector Backbone:pCAGGS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23103964
Comments: The S->T point mutation found in the Addgene QC sequence does not affect the plasmid function.
Proper citation: RRID:Addgene_42227 Copy
Genetic Insert: humanized S. pyogenes Cas9
Vector Backbone Description: Vector Backbone:pUC ori vector; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23287718
Comments: Note, Addgene's quality control sequencing has found a few discrepancies with the depositor's full sequence. The depositing lab is aware of these discrepancies, and they are not thought to affect plasmid function.
For more information on Zhang Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/zhang/
Proper citation: RRID:Addgene_42229 Copy
Species: Mus musculus
Genetic Insert: G protein Gamma 3(F70A, F71A)
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23213235
Comments: Mutations created by using the Quik Change Mutagenesis kit.
Proper citation: RRID:Addgene_42185 Copy
Species: Synthetic
Genetic Insert: GR-GECO1.1
Vector Backbone Description: Backbone Size:3200; Vector Backbone:modified pcDNA3.1; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23256581
Proper citation: RRID:Addgene_42186 Copy
Species: Synthetic
Genetic Insert: GR-GECO1.2
Vector Backbone Description: Backbone Size:3200; Vector Backbone:modified pcDNA3.1; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23256581
Proper citation: RRID:Addgene_42187 Copy
Species: Mus musculus
Genetic Insert: Gamma 3(K68A,K69A,F70A,F71A)
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23213235
Comments: Mutations created by using the Quik Change mutagenesis kit
Proper citation: RRID:Addgene_42189 Copy
Species: E. coli K-12
Genetic Insert: dam
Vector Backbone Description: Vector Backbone:pBAD18; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12897023
Proper citation: RRID:Addgene_42216 Copy
Species: Homo sapiens
Genetic Insert: Insulin-like growth factor 2 mRNA binding protein 2-2 antisense control
Vector Backbone Description: Backbone Marker:invitrogen; Backbone Size:6157; Vector Backbone:pcDNA3.1/CT-GFP TOPO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23257922
Proper citation: RRID:Addgene_42174 Copy
Species: Synthetic
Genetic Insert: PIP-SHOW
Vector Backbone Description: Backbone Size:3931; Vector Backbone:pC1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22369174
Proper citation: RRID:Addgene_42212 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.