Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 112 showing 2221 ~ 2240 out of 740,017 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection

http://www.addgene.org/41682

Species: Mus musculus
Genetic Insert: Mus musculus GABA transporter 1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19948998
Comments: To generate the fluorescent mutants mGAT10XFP and mGAT1XFP* through mGAT1XFP45, the wild-type mGAT1 open reading frame (ORF) was subcloned without its original stop codon into the HindIII and EcoRI sites of the pcDNA3.1(+) expression vector multiple cloning site (MCS). XFP ORFs were then subcloned downstream from and in frame with the mGAT1 ORF at the NotI and XbaI sites of the pcDNA3.1(+) MCS. This resulted in a 12–amino acid spacer between the end of the mGAT1 sequence and the beginning of the fluorophore. The depositors modified a method for the integration of PCR fragments without the use of restriction enzymes (Geiser et al., 2001) to add the final 3, 8, 20, 28, or 45 codons of the human GAT1 (hGAT1) ORF. These were amplified from a source plasmid using the proof-reading PfuTurbo Cx Hotstart polymerase with 5′ and 3′ extensions corresponding to the 20–22-nt regions that flanked the intended site of insertion, such that the PCR product integrated in-frame immediately after the fluorophore sequence when used as the primers in a subsequent QuikChange II XL mutagenesis PCR reaction. For mGAT1XFP*, the depositors simply added a GTC codon for Val after the fluorophore ORF. The attached image displays the protein sequences of the modified regions of mGAT1 for each fluorescent construct. mGAT10CFP and mGAT10YFP repeated the fusion design of mGAT10GFP but with the fluorophore exchanged as annotated. The three C-terminal residues of the mGAT0XFP fusions are -YKI-CO2−, which comprises a broadly defined consensus PDZ class II–interacting motif (X-φ-X-φ, where φ designates a hydrophobic residue and X any residue) (Sheng and Sala, 2001; Hung and Sheng, 2002). The depositors searched the Ensembl databases using Biomart (http://www.ebi.ac.uk/biomart) (Spudich et al., 2007) and applied the GO:0005886 “plasma membrane” cellular component filter. The search identified no known membrane proteins possessing the -YKI-CO2− C-terminal sequence. In the mGAT1XFP* constructs, the depositors defined the terminal residue P(0) more narrowly, changing the terminal isoleucine residue present in mGAT10XFP to a valine in mGAT1XFP*. The resulting C-terminal sequence, -YKV-CO2−, reconstituted a functional PDZ class II–interacting motif present in Ephrin B receptors, a class that relies on interactions with the PDZ domain–containing proteins for clustering (Torres et al., 1998; Brückner et al., 1999; Lin et al., 1999; Madsen et al., 2005). Other constructs in the C-terminal XFP fusion series, mGAT1XFP3, mGAT1XFP8, mGAT1XFP20, mGAT1XFP28, and mGAT1XFP45, had the most C-terminal 3, 8, 20, 28, or 45 residues of the hGAT1 appended after the mGAT1XFP fusion. The differences in nucleotide sequence between the hGAT1 and mGAT1 C termini were a useful source of positive identification when the depositors analyzed the clones during construction. PCR integration was applied to amplify and insert EYFP or ECFP directly between residues R565 and L566, I570 and Q571, or V577 and R578 of mGAT1 to generate the mGAT15xxXFP5xxCT constructs. The site of XFP insertion in GAT1 is highlighted in the nomenclatures for these constructs by residue numbers flanking the fluorophore, and the “CT” denotes that the insertion occurs within the C terminus. Please see the associated article for more detailed information regarding construct creation and usage.

Proper citation: RRID:Addgene_41682 Copy   


http://www.addgene.org/41681

Species: Mus musculus
Genetic Insert: Mus musculus GABA transporter 1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19948998
Comments: To generate the fluorescent mutants mGAT10XFP and mGAT1XFP* through mGAT1XFP45, the wild-type mGAT1 open reading frame (ORF) was subcloned without its original stop codon into the HindIII and EcoRI sites of the pcDNA3.1(+) expression vector multiple cloning site (MCS). XFP ORFs were then subcloned downstream from and in frame with the mGAT1 ORF at the NotI and XbaI sites of the pcDNA3.1(+) MCS. This resulted in a 12–amino acid spacer between the end of the mGAT1 sequence and the beginning of the fluorophore. The depositors modified a method for the integration of PCR fragments without the use of restriction enzymes (Geiser et al., 2001) to add the final 3, 8, 20, 28, or 45 codons of the human GAT1 (hGAT1) ORF. These were amplified from a source plasmid using the proof-reading PfuTurbo Cx Hotstart polymerase with 5′ and 3′ extensions corresponding to the 20–22-nt regions that flanked the intended site of insertion, such that the PCR product integrated in-frame immediately after the fluorophore sequence when used as the primers in a subsequent QuikChange II XL mutagenesis PCR reaction. For mGAT1XFP*, the depositors simply added a GTC codon for Val after the fluorophore ORF. The attached image displays the protein sequences of the modified regions of mGAT1 for each fluorescent construct. mGAT10CFP and mGAT10YFP repeated the fusion design of mGAT10GFP but with the fluorophore exchanged as annotated. The three C-terminal residues of the mGAT0XFP fusions are -YKI-CO2−, which comprises a broadly defined consensus PDZ class II–interacting motif (X-φ-X-φ, where φ designates a hydrophobic residue and X any residue) (Sheng and Sala, 2001; Hung and Sheng, 2002). The depositors searched the Ensembl databases using Biomart (http://www.ebi.ac.uk/biomart) (Spudich et al., 2007) and applied the GO:0005886 “plasma membrane” cellular component filter. The search identified no known membrane proteins possessing the -YKI-CO2− C-terminal sequence. In the mGAT1XFP* constructs, the depositors defined the terminal residue P(0) more narrowly, changing the terminal isoleucine residue present in mGAT10XFP to a valine in mGAT1XFP*. The resulting C-terminal sequence, -YKV-CO2−, reconstituted a functional PDZ class II–interacting motif present in Ephrin B receptors, a class that relies on interactions with the PDZ domain–containing proteins for clustering (Torres et al., 1998; Brückner et al., 1999; Lin et al., 1999; Madsen et al., 2005). Other constructs in the C-terminal XFP fusion series, mGAT1XFP3, mGAT1XFP8, mGAT1XFP20, mGAT1XFP28, and mGAT1XFP45, had the most C-terminal 3, 8, 20, 28, or 45 residues of the hGAT1 appended after the mGAT1XFP fusion. The differences in nucleotide sequence between the hGAT1 and mGAT1 C termini were a useful source of positive identification when the depositors analyzed the clones during construction. PCR integration was applied to amplify and insert EYFP or ECFP directly between residues R565 and L566, I570 and Q571, or V577 and R578 of mGAT1 to generate the mGAT15xxXFP5xxCT constructs. The site of XFP insertion in GAT1 is highlighted in the nomenclatures for these constructs by residue numbers flanking the fluorophore, and the “CT” denotes that the insertion occurs within the C terminus. Please see the associated article for more detailed information regarding construct creation and usage.

Proper citation: RRID:Addgene_41681 Copy   


http://www.addgene.org/41680

Species: Mus musculus
Genetic Insert: Mus musculus GABA transporter 1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19948998
Comments: To generate the fluorescent mutants mGAT10XFP and mGAT1XFP* through mGAT1XFP45, the wild-type mGAT1 open reading frame (ORF) was subcloned without its original stop codon into the HindIII and EcoRI sites of the pcDNA3.1(+) expression vector multiple cloning site (MCS). XFP ORFs were then subcloned downstream from and in frame with the mGAT1 ORF at the NotI and XbaI sites of the pcDNA3.1(+) MCS. This resulted in a 12–amino acid spacer between the end of the mGAT1 sequence and the beginning of the fluorophore. The depositors modified a method for the integration of PCR fragments without the use of restriction enzymes (Geiser et al., 2001) to add the final 3, 8, 20, 28, or 45 codons of the human GAT1 (hGAT1) ORF. These were amplified from a source plasmid using the proof-reading PfuTurbo Cx Hotstart polymerase with 5′ and 3′ extensions corresponding to the 20–22-nt regions that flanked the intended site of insertion, such that the PCR product integrated in-frame immediately after the fluorophore sequence when used as the primers in a subsequent QuikChange II XL mutagenesis PCR reaction. For mGAT1XFP*, the depositors simply added a GTC codon for Val after the fluorophore ORF. The attached image displays the protein sequences of the modified regions of mGAT1 for each fluorescent construct. mGAT10CFP and mGAT10YFP repeated the fusion design of mGAT10GFP but with the fluorophore exchanged as annotated. The three C-terminal residues of the mGAT0XFP fusions are -YKI-CO2−, which comprises a broadly defined consensus PDZ class II–interacting motif (X-φ-X-φ, where φ designates a hydrophobic residue and X any residue) (Sheng and Sala, 2001; Hung and Sheng, 2002). The depositors searched the Ensembl databases using Biomart (http://www.ebi.ac.uk/biomart) (Spudich et al., 2007) and applied the GO:0005886 “plasma membrane” cellular component filter. The search identified no known membrane proteins possessing the -YKI-CO2− C-terminal sequence. In the mGAT1XFP* constructs, the depositors defined the terminal residue P(0) more narrowly, changing the terminal isoleucine residue present in mGAT10XFP to a valine in mGAT1XFP*. The resulting C-terminal sequence, -YKV-CO2−, reconstituted a functional PDZ class II–interacting motif present in Ephrin B receptors, a class that relies on interactions with the PDZ domain–containing proteins for clustering (Torres et al., 1998; Brückner et al., 1999; Lin et al., 1999; Madsen et al., 2005). Other constructs in the C-terminal XFP fusion series, mGAT1XFP3, mGAT1XFP8, mGAT1XFP20, mGAT1XFP28, and mGAT1XFP45, had the most C-terminal 3, 8, 20, 28, or 45 residues of the hGAT1 appended after the mGAT1XFP fusion. The differences in nucleotide sequence between the hGAT1 and mGAT1 C termini were a useful source of positive identification when the depositors analyzed the clones during construction. PCR integration was applied to amplify and insert EYFP or ECFP directly between residues R565 and L566, I570 and Q571, or V577 and R578 of mGAT1 to generate the mGAT15xxXFP5xxCT constructs. The site of XFP insertion in GAT1 is highlighted in the nomenclatures for these constructs by residue numbers flanking the fluorophore, and the “CT” denotes that the insertion occurs within the C terminus. Please see the associated article for more detailed information regarding construct creation and usage.

Proper citation: RRID:Addgene_41680 Copy   


  • RRID:Addgene_41715

http://www.addgene.org/41715

Species: Gallus gallus
Genetic Insert: mutated C-terminal portion of calmodulin gene (M76-K148)
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2745; Vector Backbone:pEXP5-NT/TOPO; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21482808

Proper citation: RRID:Addgene_41715 Copy   


  • RRID:Addgene_41712

    This resource has 1+ mentions.

http://www.addgene.org/41712

Species: Mus musculus
Genetic Insert: Numb
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:5472; Vector Backbone:pCI-neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16832352

Proper citation: RRID:Addgene_41712 Copy   


  • RRID:Addgene_41833

http://www.addgene.org/41833

Species: Danio rerio
Genetic Insert: cadherin 5
Vector Backbone Description: Backbone Marker:Dan Carlson (Addgene plasmid# 38142); Backbone Size:4651; Vector Backbone:RCIscript-GoldyTALEN; Vector Types:cloning vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23000899
Comments: The cdh5 TALEN recognition sequences are: left TALEN 5′-CTCCTCAACATACATACT-3′ and right TALEN 5′-ACAAATGATTCATCTT-3′. Between the two binding sites is a 16-bp spacer containing a HincII site (GGAGAGTTAGTTGACA). See Addgene plasmid# 41834 and the associated publication for more information.

Proper citation: RRID:Addgene_41833 Copy   


http://www.addgene.org/41678

Species: Mus musculus
Genetic Insert: Mus musculus GABA transporter 1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19948998
Comments: To generate the fluorescent mutants mGAT10XFP and mGAT1XFP* through mGAT1XFP45, the wild-type mGAT1 open reading frame (ORF) was subcloned without its original stop codon into the HindIII and EcoRI sites of the pcDNA3.1(+) expression vector multiple cloning site (MCS). XFP ORFs were then subcloned downstream from and in frame with the mGAT1 ORF at the NotI and XbaI sites of the pcDNA3.1(+) MCS. This resulted in a 12–amino acid spacer between the end of the mGAT1 sequence and the beginning of the fluorophore. The depositors modified a method for the integration of PCR fragments without the use of restriction enzymes (Geiser et al., 2001) to add the final 3, 8, 20, 28, or 45 codons of the human GAT1 (hGAT1) ORF. These were amplified from a source plasmid using the proof-reading PfuTurbo Cx Hotstart polymerase with 5′ and 3′ extensions corresponding to the 20–22-nt regions that flanked the intended site of insertion, such that the PCR product integrated in-frame immediately after the fluorophore sequence when used as the primers in a subsequent QuikChange II XL mutagenesis PCR reaction. For mGAT1XFP*, the depositors simply added a GTC codon for Val after the fluorophore ORF. The attached image displays the protein sequences of the modified regions of mGAT1 for each fluorescent construct. mGAT10CFP and mGAT10YFP repeated the fusion design of mGAT10GFP but with the fluorophore exchanged as annotated. The three C-terminal residues of the mGAT0XFP fusions are -YKI-CO2−, which comprises a broadly defined consensus PDZ class II–interacting motif (X-φ-X-φ, where φ designates a hydrophobic residue and X any residue) (Sheng and Sala, 2001; Hung and Sheng, 2002). The depositors searched the Ensembl databases using Biomart (http://www.ebi.ac.uk/biomart) (Spudich et al., 2007) and applied the GO:0005886 “plasma membrane” cellular component filter. The search identified no known membrane proteins possessing the -YKI-CO2− C-terminal sequence. In the mGAT1XFP* constructs, the depositors defined the terminal residue P(0) more narrowly, changing the terminal isoleucine residue present in mGAT10XFP to a valine in mGAT1XFP*. The resulting C-terminal sequence, -YKV-CO2−, reconstituted a functional PDZ class II–interacting motif present in Ephrin B receptors, a class that relies on interactions with the PDZ domain–containing proteins for clustering (Torres et al., 1998; Brückner et al., 1999; Lin et al., 1999; Madsen et al., 2005). Other constructs in the C-terminal XFP fusion series, mGAT1XFP3, mGAT1XFP8, mGAT1XFP20, mGAT1XFP28, and mGAT1XFP45, had the most C-terminal 3, 8, 20, 28, or 45 residues of the hGAT1 appended after the mGAT1XFP fusion. The differences in nucleotide sequence between the hGAT1 and mGAT1 C termini were a useful source of positive identification when the depositors analyzed the clones during construction. PCR integration was applied to amplify and insert EYFP or ECFP directly between residues R565 and L566, I570 and Q571, or V577 and R578 of mGAT1 to generate the mGAT15xxXFP5xxCT constructs. The site of XFP insertion in GAT1 is highlighted in the nomenclatures for these constructs by residue numbers flanking the fluorophore, and the “CT” denotes that the insertion occurs within the C terminus. Please see the associated article for more detailed information regarding construct creation and usage.

Proper citation: RRID:Addgene_41678 Copy   


  • RRID:Addgene_41710

    This resource has 1+ mentions.

http://www.addgene.org/41710

Species: Mus musculus
Genetic Insert: tet methylcytosine dioxygenase 2
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:6174; Vector Backbone:pEF1a; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21057493

Proper citation: RRID:Addgene_41710 Copy   


http://www.addgene.org/41676

Species: Mus musculus
Genetic Insert: Mus musculus GABA transporter 1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19948998
Comments: To generate the fluorescent mutants mGAT10XFP and mGAT1XFP* through mGAT1XFP45, the wild-type mGAT1 open reading frame (ORF) was subcloned without its original stop codon into the HindIII and EcoRI sites of the pcDNA3.1(+) expression vector multiple cloning site (MCS). XFP ORFs were then subcloned downstream from and in frame with the mGAT1 ORF at the NotI and XbaI sites of the pcDNA3.1(+) MCS. This resulted in a 12–amino acid spacer between the end of the mGAT1 sequence and the beginning of the fluorophore. The depositors modified a method for the integration of PCR fragments without the use of restriction enzymes (Geiser et al., 2001) to add the final 3, 8, 20, 28, or 45 codons of the human GAT1 (hGAT1) ORF. These were amplified from a source plasmid using the proof-reading PfuTurbo Cx Hotstart polymerase with 5′ and 3′ extensions corresponding to the 20–22-nt regions that flanked the intended site of insertion, such that the PCR product integrated in-frame immediately after the fluorophore sequence when used as the primers in a subsequent QuikChange II XL mutagenesis PCR reaction. For mGAT1XFP*, the depositors simply added a GTC codon for Val after the fluorophore ORF. The attached image displays the protein sequences of the modified regions of mGAT1 for each fluorescent construct. mGAT10CFP and mGAT10YFP repeated the fusion design of mGAT10GFP but with the fluorophore exchanged as annotated. The three C-terminal residues of the mGAT0XFP fusions are -YKI-CO2−, which comprises a broadly defined consensus PDZ class II–interacting motif (X-φ-X-φ, where φ designates a hydrophobic residue and X any residue) (Sheng and Sala, 2001; Hung and Sheng, 2002). The depositors searched the Ensembl databases using Biomart (http://www.ebi.ac.uk/biomart) (Spudich et al., 2007) and applied the GO:0005886 “plasma membrane” cellular component filter. The search identified no known membrane proteins possessing the -YKI-CO2− C-terminal sequence. In the mGAT1XFP* constructs, the depositors defined the terminal residue P(0) more narrowly, changing the terminal isoleucine residue present in mGAT10XFP to a valine in mGAT1XFP*. The resulting C-terminal sequence, -YKV-CO2−, reconstituted a functional PDZ class II–interacting motif present in Ephrin B receptors, a class that relies on interactions with the PDZ domain–containing proteins for clustering (Torres et al., 1998; Brückner et al., 1999; Lin et al., 1999; Madsen et al., 2005). Other constructs in the C-terminal XFP fusion series, mGAT1XFP3, mGAT1XFP8, mGAT1XFP20, mGAT1XFP28, and mGAT1XFP45, had the most C-terminal 3, 8, 20, 28, or 45 residues of the hGAT1 appended after the mGAT1XFP fusion. The differences in nucleotide sequence between the hGAT1 and mGAT1 C termini were a useful source of positive identification when the depositors analyzed the clones during construction. PCR integration was applied to amplify and insert EYFP or ECFP directly between residues R565 and L566, I570 and Q571, or V577 and R578 of mGAT1 to generate the mGAT15xxXFP5xxCT constructs. The site of XFP insertion in GAT1 is highlighted in the nomenclatures for these constructs by residue numbers flanking the fluorophore, and the “CT” denotes that the insertion occurs within the C terminus. Please see the associated article for more detailed information regarding construct creation and usage.

Proper citation: RRID:Addgene_41676 Copy   


  • RRID:Addgene_41830

http://www.addgene.org/41830

Vector Backbone Description: Backbone Marker:Covalys; Backbone Size:3724; Vector Backbone:pSET7-26b; Vector Types:Bacterial Expression, Yeast Expression, PCR template; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21393538

Proper citation: RRID:Addgene_41830 Copy   


http://www.addgene.org/41675

Species: Mus musculus
Genetic Insert: Mus musculus GABA transporter 1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19948998
Comments: To generate the fluorescent mutants mGAT10XFP and mGAT1XFP* through mGAT1XFP45, the wild-type mGAT1 open reading frame (ORF) was subcloned without its original stop codon into the HindIII and EcoRI sites of the pcDNA3.1(+) expression vector multiple cloning site (MCS). XFP ORFs were then subcloned downstream from and in frame with the mGAT1 ORF at the NotI and XbaI sites of the pcDNA3.1(+) MCS. This resulted in a 12–amino acid spacer between the end of the mGAT1 sequence and the beginning of the fluorophore. The depositors modified a method for the integration of PCR fragments without the use of restriction enzymes (Geiser et al., 2001) to add the final 3, 8, 20, 28, or 45 codons of the human GAT1 (hGAT1) ORF. These were amplified from a source plasmid using the proof-reading PfuTurbo Cx Hotstart polymerase with 5′ and 3′ extensions corresponding to the 20–22-nt regions that flanked the intended site of insertion, such that the PCR product integrated in-frame immediately after the fluorophore sequence when used as the primers in a subsequent QuikChange II XL mutagenesis PCR reaction. For mGAT1XFP*, the depositors simply added a GTC codon for Val after the fluorophore ORF. The attached image displays the protein sequences of the modified regions of mGAT1 for each fluorescent construct. mGAT10CFP and mGAT10YFP repeated the fusion design of mGAT10GFP but with the fluorophore exchanged as annotated. The three C-terminal residues of the mGAT0XFP fusions are -YKI-CO2−, which comprises a broadly defined consensus PDZ class II–interacting motif (X-φ-X-φ, where φ designates a hydrophobic residue and X any residue) (Sheng and Sala, 2001; Hung and Sheng, 2002). The depositors searched the Ensembl databases using Biomart (http://www.ebi.ac.uk/biomart) (Spudich et al., 2007) and applied the GO:0005886 “plasma membrane” cellular component filter. The search identified no known membrane proteins possessing the -YKI-CO2− C-terminal sequence. In the mGAT1XFP* constructs, the depositors defined the terminal residue P(0) more narrowly, changing the terminal isoleucine residue present in mGAT10XFP to a valine in mGAT1XFP*. The resulting C-terminal sequence, -YKV-CO2−, reconstituted a functional PDZ class II–interacting motif present in Ephrin B receptors, a class that relies on interactions with the PDZ domain–containing proteins for clustering (Torres et al., 1998; Brückner et al., 1999; Lin et al., 1999; Madsen et al., 2005). Other constructs in the C-terminal XFP fusion series, mGAT1XFP3, mGAT1XFP8, mGAT1XFP20, mGAT1XFP28, and mGAT1XFP45, had the most C-terminal 3, 8, 20, 28, or 45 residues of the hGAT1 appended after the mGAT1XFP fusion. The differences in nucleotide sequence between the hGAT1 and mGAT1 C termini were a useful source of positive identification when the depositors analyzed the clones during construction. PCR integration was applied to amplify and insert EYFP or ECFP directly between residues R565 and L566, I570 and Q571, or V577 and R578 of mGAT1 to generate the mGAT15xxXFP5xxCT constructs. The site of XFP insertion in GAT1 is highlighted in the nomenclatures for these constructs by residue numbers flanking the fluorophore, and the “CT” denotes that the insertion occurs within the C terminus. Please see the associated article for more detailed information regarding construct creation and usage.

Proper citation: RRID:Addgene_41675 Copy   


  • RRID:Addgene_41795

    This resource has 1+ mentions.

http://www.addgene.org/41795

Genetic Insert: satellite repeat sequence
Vector Backbone Description: Vector Backbone:p156RRLsinpptCAGPRE; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21901007

Proper citation: RRID:Addgene_41795 Copy   


  • RRID:Addgene_41791

    This resource has 1+ mentions.

http://www.addgene.org/41791

Genetic Insert: HIV-1 Gag/Pol and RRE sequences
Vector Backbone Description: Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22612657

Proper citation: RRID:Addgene_41791 Copy   


  • RRID:Addgene_41705

http://www.addgene.org/41705

Species: Homo sapiens
Genetic Insert: Crkl
Vector Backbone Description: Backbone Size:4100; Vector Backbone:pSG5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: Constructed by Ron de Jong.

Proper citation: RRID:Addgene_41705 Copy   


  • RRID:Addgene_41826

http://www.addgene.org/41826

Vector Backbone Description: Backbone Marker:Paul Matsudaira lab; Backbone Size:3322; Vector Backbone:pAED4; Vector Types:Bacterial Expression, Yeast Expression, PCR template; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21393538

Proper citation: RRID:Addgene_41826 Copy   


http://www.addgene.org/41704

Species: Homo sapiens
Genetic Insert: Crkl
Vector Backbone Description: Backbone Size:4100; Vector Backbone:pSG5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: Constructed by Ron de Jong.

Proper citation: RRID:Addgene_41704 Copy   


  • RRID:Addgene_41825

http://www.addgene.org/41825

Vector Backbone Description: Backbone Marker:Paul Matsudaira lab; Backbone Size:3322; Vector Backbone:pAED4; Vector Types:Bacterial Expression, Yeast Expression, PCR template; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21393538

Proper citation: RRID:Addgene_41825 Copy   


  • RRID:Addgene_41823

http://www.addgene.org/41823

Species: Homo sapiens
Genetic Insert: gRNA_DNMT3b
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pCR-Blunt II-TOPO; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23287722
Comments: gRNA target sequence GAATTACTCACGCCCCAAGG

Proper citation: RRID:Addgene_41823 Copy   


  • RRID:Addgene_41667

http://www.addgene.org/41667

Species: Mus musculus
Genetic Insert: Mus musculus GABA transporter 1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19948998
Comments: To generate the fluorescent mutants mGAT10XFP and mGAT1XFP* through mGAT1XFP45, the wild-type mGAT1 open reading frame (ORF) was subcloned without its original stop codon into the HindIII and EcoRI sites of the pcDNA3.1(+) expression vector multiple cloning site (MCS). XFP ORFs were then subcloned downstream from and in frame with the mGAT1 ORF at the NotI and XbaI sites of the pcDNA3.1(+) MCS. This resulted in a 12–amino acid spacer between the end of the mGAT1 sequence and the beginning of the fluorophore. The depositors modified a method for the integration of PCR fragments without the use of restriction enzymes (Geiser et al., 2001) to add the final 3, 8, 20, 28, or 45 codons of the human GAT1 (hGAT1) ORF. These were amplified from a source plasmid using the proof-reading PfuTurbo Cx Hotstart polymerase with 5′ and 3′ extensions corresponding to the 20–22-nt regions that flanked the intended site of insertion, such that the PCR product integrated in-frame immediately after the fluorophore sequence when used as the primers in a subsequent QuikChange II XL mutagenesis PCR reaction. For mGAT1XFP*, the depositors simply added a GTC codon for Val after the fluorophore ORF. The attached image displays the protein sequences of the modified regions of mGAT1 for each fluorescent construct. mGAT10CFP and mGAT10YFP repeated the fusion design of mGAT10GFP but with the fluorophore exchanged as annotated. The three C-terminal residues of the mGAT0XFP fusions are -YKI-CO2−, which comprises a broadly defined consensus PDZ class II–interacting motif (X-φ-X-φ, where φ designates a hydrophobic residue and X any residue) (Sheng and Sala, 2001; Hung and Sheng, 2002). The depositors searched the Ensembl databases using Biomart (http://www.ebi.ac.uk/biomart) (Spudich et al., 2007) and applied the GO:0005886 “plasma membrane” cellular component filter. The search identified no known membrane proteins possessing the -YKI-CO2− C-terminal sequence. In the mGAT1XFP* constructs, the depositors defined the terminal residue P(0) more narrowly, changing the terminal isoleucine residue present in mGAT10XFP to a valine in mGAT1XFP*. The resulting C-terminal sequence, -YKV-CO2−, reconstituted a functional PDZ class II–interacting motif present in Ephrin B receptors, a class that relies on interactions with the PDZ domain–containing proteins for clustering (Torres et al., 1998; Brückner et al., 1999; Lin et al., 1999; Madsen et al., 2005). Other constructs in the C-terminal XFP fusion series, mGAT1XFP3, mGAT1XFP8, mGAT1XFP20, mGAT1XFP28, and mGAT1XFP45, had the most C-terminal 3, 8, 20, 28, or 45 residues of the hGAT1 appended after the mGAT1XFP fusion. The differences in nucleotide sequence between the hGAT1 and mGAT1 C termini were a useful source of positive identification when the depositors analyzed the clones during construction. PCR integration was applied to amplify and insert EYFP or ECFP directly between residues R565 and L566, I570 and Q571, or V577 and R578 of mGAT1 to generate the mGAT15xxXFP5xxCT constructs. The site of XFP insertion in GAT1 is highlighted in the nomenclatures for these constructs by residue numbers flanking the fluorophore, and the “CT” denotes that the insertion occurs within the C terminus. Please see the associated article for more detailed information regarding construct creation and usage.

Proper citation: RRID:Addgene_41667 Copy   


  • RRID:Addgene_41700

    This resource has 1+ mentions.

http://www.addgene.org/41700

Genetic Insert: E. coli MG1655 ΔmutS::cat Δ(ybhB-bioAB)::[λcI857 N(cro-ea59)::tetR-bla] dnaG.Q576A
Vector Backbone Description: Vector Backbone:genome; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22904085

Proper citation: RRID:Addgene_41700 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. Neuroscience Information Framework Resources

    Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within NIF that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X