Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species:
Genetic Insert: gRNA_AAVS1-T2
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pCR-Blunt II-TOPO; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Kanamycin
References:
Comments: gRNA target sequence GGGGCCACTAGGGACAGGAT
Proper citation: RRID:Addgene_41818 Copy
Species:
Genetic Insert: gRNA_AAVS1-T1
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pCR-Blunt II-TOPO; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Kanamycin
References:
Comments: gRNA target sequence GTCCCCTCCACCCCACAGTG
Proper citation: RRID:Addgene_41817 Copy
Species: Homo sapiens
Genetic Insert: IL2
Vector Backbone Description: Backbone Marker:BD; Backbone Size:9761; Vector Backbone:pAcGP67a; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_41807 Copy
Species: Homo sapiens
Genetic Insert: IL2
Vector Backbone Description: Backbone Marker:BD; Backbone Size:9761; Vector Backbone:pAcGP67a; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_41806 Copy
Species: Drosophila melanogaster
Genetic Insert: kinesin heavy chain
Vector Backbone Description: Vector Backbone:pT7-7; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_41758 Copy
Species: Drosophila melanogaster
Genetic Insert: kinesin heavy chain
Vector Backbone Description: Vector Backbone:pT7-7; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_41755 Copy
Species: Drosophila melanogaster
Genetic Insert: kinesin heavy chain
Vector Backbone Description: Vector Backbone:pT7-7; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_41753 Copy
Species: Homo sapiens
Genetic Insert: Halotag 2
Vector Backbone Description: Backbone Marker:INVITROGEN; Backbone Size:5000; Vector Backbone:PCDNA5; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments: Alternate plasmid name: pCDNA5-KGH2
Proper citation: RRID:Addgene_41742 Copy
Species: Mus musculus
Genetic Insert: Klf5
Vector Backbone Description: Backbone Marker:Oligoengine; Vector Backbone:pSuper-Retro; Vector Types:RNAi; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_41740 Copy
Species:
Genetic Insert: E. coli MG1655 ΔmutS::cat Δ(ybhB-bioAB)::[λcI857 N(cro-ea59)::tetR-bla] xonA-, recJ-,xseA-, exoX- and redα- dnaG.Q576A tolC-
Vector Backbone Description: Vector Backbone:genome; Vector Types:; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_41699 Copy
Species: Mus musculus
Genetic Insert: Notch-1 Lin-Notch-glp (LNG) repeat-containing construct, CC->SS
Vector Backbone Description: Backbone Size:4352; Vector Backbone:pCS2+MT; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: Alternate plasmid name: pCS2 NLNR CC>SS-6MT
All Notch1 constructs deposited here were cloned into the pCS2+MT vector (Rupp et al., 1994; Turner and Weintraub, 1994) and have the C-terminal 348 residues (aa 2185 to C terminus) of Notch replaced with a hexameric myc tag to facilitate biochemical analysis. PCR mutagenesis was used to create the C1675S and C1682S mutations in LNR (Addgene plasmid #41738).
Proper citation: RRID:Addgene_41739 Copy
Species: Mus musculus
Genetic Insert: Notch-1 Intracellular Domain
Vector Backbone Description: Backbone Size:4352; Vector Backbone:pCS2+MT; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: Alternate plasmid name: pCS2 NICv1744-6MT
To create pCS2+ NICV1744, the primer CCAGGATCCACCATGGTGCTGCTGTCCCGCAAGC was used with primer M95 (5'-TCGAACATTGACATCCATGCA-3') to generate a product that was digested with Bam HI and Bcl I, and ligated into the same sites in NΔE (Addgene plasmid #41737).
Proper citation: RRID:Addgene_41730 Copy
Species: Pyrococcus horikoshii
Genetic Insert: PhoCDC21-1 intein
Vector Backbone Description: Backbone Marker:novagen; Vector Backbone:pRSFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_41695 Copy
Species: Methanococcus jannaschii
Genetic Insert: MjaTFIIB intein
Vector Backbone Description: Backbone Marker:novagen; Vector Backbone:pRSFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_41694 Copy
Species: Homo sapiens
Genetic Insert: DNAJA4 3'UTR
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:6200; Vector Backbone:psiCheck2; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
References:
Comments: Full-length 3′UTR of DNAJA4 was cloned downstream of a renilla luciferase reporter into the psiCheck2 dual luciferase reporter vector
Proper citation: RRID:Addgene_41847 Copy
Species: Homo sapiens
Genetic Insert: BRCA1
Vector Backbone Description: Backbone Size:5200; Vector Backbone:pBABE-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
References:
Comments: The BRCA1 insert in this plasmid contains the following common polymorphisms when compared to GenBank reference sequence NP_009225.1: P871L, E1038G, K1182R, and S1613G. These SNPs were likely present in the original cDNA isolate.
Proper citation: RRID:Addgene_41968 Copy
Species: Homo sapiens
Genetic Insert: ApoE 3'UTR
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:6273; Vector Backbone:psiCheck2; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
References:
Comments: Full-length 3′UTR of ApoE was cloned downstream of renilla luciferase reporter in the psiCheck2 dual luciferase reporter vector
Proper citation: RRID:Addgene_41846 Copy
Species: Synthetic
Genetic Insert: 4-4-20
Vector Backbone Description: Backbone Size:6142; Vector Backbone:pCT; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_41845 Copy
Species: Synthetic
Genetic Insert: 4M5.3
Vector Backbone Description: Backbone Size:6142; Vector Backbone:pCT; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_41844 Copy
Species: Homo sapiens
Genetic Insert: TNRC6A
Vector Backbone Description: Backbone Size:5338; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_42011 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.