Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
The Antibody Registry is the authoritative source for antibody identifiers, which can be used in publications to uniquely mark the antibodies used in a paper.
| Antibody Name | Proper Citation | Target Antigen | Target Organism |
Clone ID |
Defining Citation |
Comments |
|||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
anti-Calicin (N-terminus) guinea pig polyclonal, serum Resource Report Resource Website |
Progen Cat# GP-SH3, RRID:AB_3668769 | CCIN | rat, mouse, rabbit, bovine, human | Applications: IHC, WB | polyclonal | Guinea pig | AB_3668769 | Progen | GP-SH3 | 2025-08-20 04:12:57 | 0 | ||
|
Guinea pig Anti-ASIC3 Polyclonal Antibody, Unconjugated Resource Report Resource Website Discontinued |
GeneTex Cat# GTX10354, RRID:AB_381009 | ASIC3 | Discontinued; manufacturer recommendations: Immunocytochemistry; Immunohistochemistry; ICC, IHC-Fr | polyclonal | guinea pig | AB_381009 | GeneTex | GTX10354 | 2025-08-20 04:13:10 | 0 | |||
|
Insulin antibody Resource Report Resource Website 50+ mentions Rating or validation data |
Abcam Cat# ab7842, RRID:AB_306130 | Insulin antibody | rat, hamster, mouse, human |
Applications: Flow Cyt, ICC/IF, IHC-FoFr, IHC-Fr, IHC-P; Immunofluorescence; Immunohistochemistry; Immunohistochemistry - fixed; Immunocytochemistry; Flow Cytometry; Western Blot; Immunohistochemistry - frozen Info: Used by Czech Centre for Phenogenomics |
polyclonal | guinea pig | AB_306130 | Abcam | ab7842 | 2025-08-20 08:18:04 | 61 | ||
|
VAMP-1, pAb Resource Report Resource Website |
Enzo Life Sciences Cat# ALX-210-791, RRID:AB_2214770 | VAMP1 | rat, mouse, dog, human | Useful for western blot, immunoprecipitation | polyclonal | guinea pig | AB_2214770 | Enzo Life Sciences | ALX-210-791 | 2025-08-20 08:18:04 | 0 | ||
|
eGFP Resource Report Resource Website 1+ mentions |
Takeshi Kaneko - Kyoto University Cat# eGFP1, RRID:AB_2921270 | artificial protein | eGFP | PMID:11070189 | Tamamaki et a., 2000. Neurons in Golgi-stain-like images revealed by GFP-adenovirus infection in vivo. Neurosci Res 38:231– 236: "For the production of anti-GFP antibodies, the full coding sequence of GFP was amplified by polymerase chain reaction (PCR) by using the pGG16 as a template. The sequences of the primers used for the PCR were ATGGTGAGCAAGGGCGAGGA and CTTGTACAGCTCGTCCATGC. The blunt-ended PCR product was cloned into pGEX-4T2 (Amersham-Pharmacia Biotech, USA) at the SmaI site, and glutathioneS-transferase(GST)-GFP fusion protein was induced in E. coli by adding isopropyl-1-thio-beta-D-galactopyranoside (IPTG) to the medium. GFP was purified according to the protocol recommended by the manufacturer of the GST-system (Amersham-Pharmacia Biotech, USA). The purified GFP was emulsified with Freund’s complete adjuvant (Difco, USA; Johnstone and Thorpe, 1987), and injected intracutaneously into female rabbits (2 mg/animal) and guinea pigs (0.5 mg/animal). Four weeks after the immunization, the same amount of GFP emulsified with incomplete Freund’s adjuvant was injected into the animals. The sera were recovered 10–20 days after the second immunization. Antibodies were further affinity-purified with GFP-conjugated Affigel 10 gel (BioRad, USA); (2 mg GFP/1 ml gel). After 25 mg of crude g-globulin fraction was applied to 1 ml of the antigen column, the specific antibodies were eluted with 0.1 M glycine-HCl, pH2.5." | polyclonal | guinea pig | AB_2921270 | Takeshi Kaneko - Kyoto University | eGFP1 | 2025-08-20 08:18:12 | 1 | |
|
Anti-Parvalbumin Resource Report Resource Website 1+ mentions |
Millipore Cat# AB15738, RRID:AB_838236 | Human Parvalbumin | human | seller recommendations: Immunohistochemistry; Immunohistochemistry (Paraffin) | unknown | guinea pig | AB_838236 | Millipore | AB15738 | 2025-08-20 08:19:03 | 2 | ||
|
PTX3, pAb Resource Report Resource Website |
Enzo Life Sciences Cat# ALX-210-365, RRID:AB_2165296 | PITX3 | rat, mouse, human | Useful for ELISA, immunoprecipitation, immunohistochemistry, immunocytochemistry | polyclonal | guinea pig | AB_2165296 | Enzo Life Sciences | ALX-210-365 | 2025-08-20 08:14:54 | 0 | ||
|
Melanocortin receptor 4, pAb Resource Report Resource Website |
Enzo Life Sciences Cat# BML-SA641, RRID:AB_2143088 | MC4R | rat, mouse, human | Useful for western blot, immunohistochemistry, immunocytochemistry | polyclonal | guinea pig | AB_2143088 | Enzo Life Sciences | BML-SA641 | 2025-08-20 08:09:53 | 0 | ||
|
Guinea pig Anti-Bovine Glucagon Antibody, Unconjugated Resource Report Resource Website |
Immundiagnostik Cat# AS1012.2, RRID:AB_769904 | Bovine Glucagon | bovine | manufacturer recommendations: Radioimmunoassay; Radioimmunoassay | unknown | guinea pig | AB_769904 | Immundiagnostik | AS1012.2 | 2025-08-20 08:10:02 | 0 | ||
|
Guinea Anti-Pig INS Polyclonal Antibody, polyclonal Resource Report Resource Website |
Creative Diagnostics Cat# CPBT-37199GP, RRID:AB_2371230 | INS | pig | 147 | unknown | guinea pig | AB_2371230 | Creative Diagnostics | CPBT-37199GP | 2025-08-20 08:10:16 | 0 | ||
|
Anti-Neurofilament H Resource Report Resource Website |
Synaptic Systems Cat# 171 104, RRID:AB_2619869 | Neurofilament H | Rat, Mouse | Applications: ICC,IHC,IHC-P | polyclonal | guinea pig | AB_2619869 | Synaptic Systems | 171 104 | 2025-08-20 08:10:09 | 0 | ||
|
Guinea Pig Anti-HIV HIV-1 Reverse Transcriptase Polyclonal Antibody, Unconjugated Resource Report Resource Website |
Cosmo Bio Cat# BAM-65-003, RRID:AB_605028 | HIV HIV-1 Reverse Transcriptase | hiv | functionality unknown, check validation data for this product with vendor | polyclonal | guinea pig | AB_605028 | Cosmo Bio | BAM-65-003 | 2025-08-20 08:12:39 | 0 | ||
|
Guinea pig Anti-Insulin Polyclonal antibody, Unconjugated Resource Report Resource Website 1+ mentions |
Millipore Cat# AB3440, RRID:AB_2126544 | Insulin | porcine, pig, bovine, human | seller recommendations: Immunohistochemistry; Western Blot; Western Blotting, Immunohistochemistry | polyclonal | guinea pig | AB_2126544 | Millipore | AB3440 | 2025-08-20 08:11:26 | 3 | ||
|
Anti-KRT15 / Cytokeratin 15 Resource Report Resource Website |
LSBio (LifeSpan) Cat# LS-C22643-100, RRID:AB_902716 | KRT15 / Cytokeratin 15 | Human, Mouse | vendor suggested use: IgG; IgG IHC-Fr, WB (1:2000); Immunohistochemistry; Western Blot; Immunohistochemistry - frozen | polyclonal | guinea pig | AB_902716 | LSBio (LifeSpan) | LS-C22643-100 | 2025-08-20 08:11:48 | 0 | ||
|
ProDynorphin antibody Resource Report Resource Website 1+ mentions |
Abcam Cat# ab10280, RRID:AB_297019 | ProDynorphin antibody | rat, mouse, human | validation status unknown, seller recommendations provided in 2012: Immunohistochemistry; Immunohistochemistry - frozen; IHC-Fr | polyclonal | guinea pig | AB_297019 | Abcam | ab10280 | 2025-08-20 08:32:49 | 1 | ||
|
Keratin K76 antibody Resource Report Resource Website |
Fitzgerald Industries International Cat# 20R-2641, RRID:AB_11201389 | Keratin K76 antibody | manufacturer recommendations: Immunohistochemistry; Western Blot; IHC, WB | polyclonal | guinea pig | AB_11201389 | Fitzgerald Industries International | 20R-2641 | 2025-08-20 08:33:19 | 0 | |||
|
TRIF, pAb Resource Report Resource Website |
Enzo Life Sciences Cat# ALX-215-016, RRID:AB_2208976 | Trim69 | mouse, human | Useful for western blot | polyclonal | guinea pig | AB_2208976 | Enzo Life Sciences | ALX-215-016 | 2025-08-20 08:33:35 | 0 | ||
|
anti Prorelaxin / RLN Resource Report Resource Website |
Acris Antibodies Cat# AP02281SU-N, RRID:AB_1621909 | anti Prorelaxin / RLN | porcine, por | manufacturer recommendations: E; ELISA | unknown | guinea pig | AB_1621909 | Acris Antibodies | AP02281SU-N | 2025-08-20 07:52:56 | 0 | ||
|
Dnmt 2, pAb Resource Report Resource Website |
Enzo Life Sciences Cat# ALX-210-330, RRID:AB_2208298 | TRDMT1 | mouse, human | Useful for western blot | polyclonal | guinea pig | AB_2208298 | Enzo Life Sciences | ALX-210-330 | 2025-08-20 07:53:05 | 0 | ||
|
Neurokinin-1 Receptor (NK1R) Resource Report Resource Website 1+ mentions |
Biotrend Cat# NA 4200, RRID:AB_2255737 | TACR1 | human | Useful for western blot, immunohistochemistry | polyclonal | guinea pig | AB_2255737 | Biotrend | NA 4200 | 2025-08-20 07:53:30 | 1 |
Can't find your Antibody?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific antibody, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your antibody in the search results, please help us by registering it into the system — it's easy. Register it with The Antibody Registry (an Antibody Registry account is required. Create a free Antibody Registry account if you don't have one yet). An RRID will be generated in 1-2 business days.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
