Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
The Antibody Registry is the authoritative source for antibody identifiers, which can be used in publications to uniquely mark the antibodies used in a paper.
http://antibodyregistry.org/AB_3668769
Comments: Applications: IHC, WB
Host Organism: Guinea pig
Clonality polyclonal
Target(s): CCIN
Proper citation: Progen Cat# GP-SH3, RRID:AB_3668769 Copy
Discontinued
http://antibodyregistry.org/AB_381009
Comments: Discontinued; manufacturer recommendations: Immunocytochemistry; Immunohistochemistry; ICC, IHC-Fr
Host Organism: guinea pig
Clonality polyclonal
Target(s): ASIC3
Proper citation: GeneTex Cat# GTX10354, RRID:AB_381009 Copy
Ratings or validation data are available for this resource
http://antibodyregistry.org/AB_306130
Comments: Applications: Flow Cyt, ICC/IF, IHC-FoFr, IHC-Fr, IHC-P; Immunofluorescence; Immunohistochemistry; Immunohistochemistry - fixed; Immunocytochemistry; Flow Cytometry; Western Blot; Immunohistochemistry - frozen
Info: Used by Czech Centre for Phenogenomics
Host Organism: guinea pig
Clonality polyclonal
Target(s): Insulin antibody
Proper citation: Abcam Cat# ab7842, RRID:AB_306130 Copy
http://antibodyregistry.org/AB_2214770
Comments: Useful for western blot, immunoprecipitation
Host Organism: guinea pig
Clonality polyclonal
Target(s): VAMP1
Proper citation: Enzo Life Sciences Cat# ALX-210-791, RRID:AB_2214770 Copy
http://antibodyregistry.org/AB_2921270
Comments: Tamamaki et a., 2000. Neurons in Golgi-stain-like images revealed by GFP-adenovirus infection in vivo. Neurosci Res 38:231– 236: "For the production of anti-GFP antibodies, the full coding sequence of GFP was amplified by polymerase chain reaction (PCR) by using the pGG16 as a template. The sequences of the primers used for the PCR were ATGGTGAGCAAGGGCGAGGA and CTTGTACAGCTCGTCCATGC. The blunt-ended PCR product was cloned into pGEX-4T2 (Amersham-Pharmacia Biotech, USA) at the SmaI site, and glutathioneS-transferase(GST)-GFP fusion protein was induced in E. coli by adding isopropyl-1-thio-beta-D-galactopyranoside (IPTG) to the medium. GFP was purified according to the protocol recommended by the manufacturer of the GST-system (Amersham-Pharmacia Biotech, USA). The purified GFP was emulsified with Freund’s complete adjuvant (Difco, USA; Johnstone and Thorpe, 1987), and injected intracutaneously into female rabbits (2 mg/animal) and guinea pigs (0.5 mg/animal). Four weeks after the immunization, the same amount of GFP emulsified with incomplete Freund’s adjuvant was injected into the animals. The sera were recovered 10–20 days after the second immunization. Antibodies were further affinity-purified with GFP-conjugated Affigel 10 gel (BioRad, USA); (2 mg GFP/1 ml gel). After 25 mg of crude g-globulin fraction was applied to 1 ml of the antigen column, the specific antibodies were eluted with 0.1 M glycine-HCl, pH2.5."
Host Organism: guinea pig
Clonality polyclonal
Target(s): artificial protein
Proper citation: Takeshi Kaneko - Kyoto University Cat# eGFP1, RRID:AB_2921270 Copy
http://antibodyregistry.org/AB_838236
Comments: seller recommendations: Immunohistochemistry; Immunohistochemistry (Paraffin)
Host Organism: guinea pig
Clonality unknown
Target(s): Human Parvalbumin
Proper citation: Millipore Cat# AB15738, RRID:AB_838236 Copy
http://antibodyregistry.org/AB_2165296
Comments: Useful for ELISA, immunoprecipitation, immunohistochemistry, immunocytochemistry
Host Organism: guinea pig
Clonality polyclonal
Target(s): PITX3
Proper citation: Enzo Life Sciences Cat# ALX-210-365, RRID:AB_2165296 Copy
http://antibodyregistry.org/AB_2143088
Comments: Useful for western blot, immunohistochemistry, immunocytochemistry
Host Organism: guinea pig
Clonality polyclonal
Target(s): MC4R
Proper citation: Enzo Life Sciences Cat# BML-SA641, RRID:AB_2143088 Copy
http://antibodyregistry.org/AB_769904
Comments: manufacturer recommendations: Radioimmunoassay; Radioimmunoassay
Host Organism: guinea pig
Clonality unknown
Target(s): Bovine Glucagon
Proper citation: Immundiagnostik Cat# AS1012.2, RRID:AB_769904 Copy
http://antibodyregistry.org/AB_2371230
Comments:
Host Organism: guinea pig
Clonality unknown
Target(s): INS
Proper citation: Creative Diagnostics Cat# CPBT-37199GP, RRID:AB_2371230 Copy
http://antibodyregistry.org/AB_2619869
Comments: Applications: ICC,IHC,IHC-P
Host Organism: guinea pig
Clonality polyclonal
Target(s): Neurofilament H
Proper citation: Synaptic Systems Cat# 171 104, RRID:AB_2619869 Copy
http://antibodyregistry.org/AB_605028
Comments: functionality unknown, check validation data for this product with vendor
Host Organism: guinea pig
Clonality polyclonal
Target(s): HIV HIV-1 Reverse Transcriptase
Proper citation: Cosmo Bio Cat# BAM-65-003, RRID:AB_605028 Copy
http://antibodyregistry.org/AB_2126544
Comments: seller recommendations: Immunohistochemistry; Western Blot; Western Blotting, Immunohistochemistry
Host Organism: guinea pig
Clonality polyclonal
Target(s): Insulin
Proper citation: Millipore Cat# AB3440, RRID:AB_2126544 Copy
http://antibodyregistry.org/AB_902716
Comments: vendor suggested use: IgG; IgG IHC-Fr, WB (1:2000); Immunohistochemistry; Western Blot; Immunohistochemistry - frozen
Host Organism: guinea pig
Clonality polyclonal
Target(s): KRT15 / Cytokeratin 15
Proper citation: LSBio (LifeSpan) Cat# LS-C22643-100, RRID:AB_902716 Copy
http://antibodyregistry.org/AB_297019
Comments: validation status unknown, seller recommendations provided in 2012: Immunohistochemistry; Immunohistochemistry - frozen; IHC-Fr
Host Organism: guinea pig
Clonality polyclonal
Target(s): ProDynorphin antibody
Proper citation: Abcam Cat# ab10280, RRID:AB_297019 Copy
http://antibodyregistry.org/AB_11201389
Comments: manufacturer recommendations: Immunohistochemistry; Western Blot; IHC, WB
Host Organism: guinea pig
Clonality polyclonal
Target(s): Keratin K76 antibody
Proper citation: Fitzgerald Industries International Cat# 20R-2641, RRID:AB_11201389 Copy
http://antibodyregistry.org/AB_2208976
Comments: Useful for western blot
Host Organism: guinea pig
Clonality polyclonal
Target(s): Trim69
Proper citation: Enzo Life Sciences Cat# ALX-215-016, RRID:AB_2208976 Copy
http://antibodyregistry.org/AB_1621909
Comments: manufacturer recommendations: E; ELISA
Host Organism: guinea pig
Clonality unknown
Target(s): anti Prorelaxin / RLN
Proper citation: Acris Antibodies Cat# AP02281SU-N, RRID:AB_1621909 Copy
http://antibodyregistry.org/AB_2208298
Comments: Useful for western blot
Host Organism: guinea pig
Clonality polyclonal
Target(s): TRDMT1
Proper citation: Enzo Life Sciences Cat# ALX-210-330, RRID:AB_2208298 Copy
http://antibodyregistry.org/AB_2255737
Comments: Useful for western blot, immunohistochemistry
Host Organism: guinea pig
Clonality polyclonal
Target(s): TACR1
Proper citation: Biotrend Cat# NA 4200, RRID:AB_2255737 Copy
Can't find your Antibody?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific antibody, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your antibody in the search results, please help us by registering it into the system — it's easy. Register it with The Antibody Registry (an Antibody Registry account is required. Create a free Antibody Registry account if you don't have one yet). An RRID will be generated in 1-2 business days.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
