Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
The Antibody Registry is the authoritative source for antibody identifiers, which can be used in publications to uniquely mark the antibodies used in a paper.
http://antibodyregistry.org/AB_870958
Comments: seller recommendations: Immunohistochemistry; Immunohistochemistry
Host Organism: guinea pig
Clonality unknown
Target(s): Sheep Alpha Melanocyte Stimulating Protein
Proper citation: Millipore Cat# AB15698, RRID:AB_870958 Copy
http://antibodyregistry.org/AB_2921270
Comments: Tamamaki et a., 2000. Neurons in Golgi-stain-like images revealed by GFP-adenovirus infection in vivo. Neurosci Res 38:231– 236: "For the production of anti-GFP antibodies, the full coding sequence of GFP was amplified by polymerase chain reaction (PCR) by using the pGG16 as a template. The sequences of the primers used for the PCR were ATGGTGAGCAAGGGCGAGGA and CTTGTACAGCTCGTCCATGC. The blunt-ended PCR product was cloned into pGEX-4T2 (Amersham-Pharmacia Biotech, USA) at the SmaI site, and glutathioneS-transferase(GST)-GFP fusion protein was induced in E. coli by adding isopropyl-1-thio-beta-D-galactopyranoside (IPTG) to the medium. GFP was purified according to the protocol recommended by the manufacturer of the GST-system (Amersham-Pharmacia Biotech, USA). The purified GFP was emulsified with Freund’s complete adjuvant (Difco, USA; Johnstone and Thorpe, 1987), and injected intracutaneously into female rabbits (2 mg/animal) and guinea pigs (0.5 mg/animal). Four weeks after the immunization, the same amount of GFP emulsified with incomplete Freund’s adjuvant was injected into the animals. The sera were recovered 10–20 days after the second immunization. Antibodies were further affinity-purified with GFP-conjugated Affigel 10 gel (BioRad, USA); (2 mg GFP/1 ml gel). After 25 mg of crude g-globulin fraction was applied to 1 ml of the antigen column, the specific antibodies were eluted with 0.1 M glycine-HCl, pH2.5."
Host Organism: guinea pig
Clonality polyclonal
Target(s): artificial protein
Proper citation: Takeshi Kaneko - Kyoto University Cat# eGFP1, RRID:AB_2921270 Copy
http://antibodyregistry.org/AB_838236
Comments: seller recommendations: Immunohistochemistry; Immunohistochemistry (Paraffin)
Host Organism: guinea pig
Clonality unknown
Target(s): Human Parvalbumin
Proper citation: Millipore Cat# AB15738, RRID:AB_838236 Copy
http://antibodyregistry.org/AB_2756841
Comments:
Host Organism: guinea pig
Clonality polyclonal
Target(s): Prolactin
Proper citation: A.F. Parlow National Hormone and Peptide Program Cat# AFP65191, RRID:AB_2756841 Copy
Discontinued
http://antibodyregistry.org/AB_11435321
Comments: Discontinued: 2015; Discontinued on 27 July 2015; IHC
Host Organism: guinea pig
Clonality polyclonal
Target(s): PDYN
Proper citation: Creative Biomart Cat# CPBT-44263GR, RRID:AB_11435321 Copy
http://antibodyregistry.org/AB_2179905
Comments: Useful for western blot, ELISA
Host Organism: guinea pig
Clonality polyclonal
Target(s): RETN
Proper citation: Enzo Life Sciences Cat# ALX-210-388, RRID:AB_2179905 Copy
http://antibodyregistry.org/AB_1547385
Comments: Applications: WB,IP,ICC,IHC,IHC-P
Host Organism: guinea pig
Clonality polyclonal
Target(s): Tau
Proper citation: Synaptic Systems Cat# 314 004, RRID:AB_1547385 Copy
http://antibodyregistry.org/AB_1511766
Comments: vendor suggested use: ELISA; Other; ELISA
Host Organism: guinea pig
Clonality polyclonal
Target(s): Pseudomonas aeruginosa
Proper citation: LSBio (LifeSpan) Cat# LS-C56523-500, RRID:AB_1511766 Copy
Discontinued
http://antibodyregistry.org/AB_1113068
Comments: Discontinued: 2014; manufacturer recommendations: Immunohistochemistry
Host Organism: guinea pig
Clonality unknown
Target(s): alpha-CGRP
Proper citation: Peninsula Laboratories Cat# T-5053.0050, RRID:AB_1113068 Copy
http://antibodyregistry.org/AB_2619805
Comments: Applications: WB,IP
Host Organism: guinea pig
Clonality polyclonal
Target(s): SAP 97
Proper citation: Synaptic Systems Cat# 124 315, RRID:AB_2619805 Copy
http://antibodyregistry.org/AB_2905579
Comments: Applications: WB
Host Organism: guinea pig
Clonality polyclonal
Target(s): Munc 13-2
Proper citation: Synaptic Systems Cat# 126 205, RRID:AB_2905579 Copy
http://antibodyregistry.org/AB_1004382
Comments: manufacturer recommendations: Immunohistochemistry; Western Blot; Immunohistochemistry-frozen, Immunohistochemistry-paraffin, Western Blot
Host Organism: guinea pig
Clonality unknown
Target(s): Hair Keratin acidic hHa2
Proper citation: Acris Antibodies Cat# BP5084, RRID:AB_1004382 Copy
Discontinued
http://antibodyregistry.org/AB_518678
Comments: Discontinued: 2014; manufacturer recommendations: Radioimmunoassay; RIA
Host Organism: guinea pig
Clonality unknown
Target(s): (Arg8)-Vasopressin - Diluted Antiserum for RIA Host: Guinea Pig
Proper citation: Peninsula Laboratories Cat# T-5047.0500, RRID:AB_518678 Copy
http://antibodyregistry.org/AB_898048
Comments: vendor suggested use: IgG; IgG Immunohistochemistry - frozen; Western Blot; Immunohistochemistry; Immunohistochemistry - fixed; IHC-Fr, IHC-P, WB (1:1000)
Host Organism: guinea pig
Clonality polyclonal
Target(s): DSP / Desmoplakin
Proper citation: LSBio (LifeSpan) Cat# LS-C22820-50, RRID:AB_898048 Copy
http://antibodyregistry.org/AB_2136078
Comments: Useful for western blot, ELISA
Host Organism: guinea pig
Clonality polyclonal
Target(s): Lep
Proper citation: Enzo Life Sciences Cat# ALX-210-382, RRID:AB_2136078 Copy
http://antibodyregistry.org/AB_3668765
Comments:
Host Organism: Guinea Pig
Clonality isotype control
Target(s): not applicable
Proper citation: Sangon Biotech Cat# D110505, RRID:AB_3668765 Copy
http://antibodyregistry.org/AB_1543078
Comments: functionality unknown, check validation data for this product with vendor
Host Organism: guinea pig
Clonality polyclonal
Target(s): Guinea Pig TIP47 / PP17
Proper citation: ARP American Research Products Cat# 03-GP32, RRID:AB_1543078 Copy
http://antibodyregistry.org/AB_1597814
Comments: vendor suggested use: ELISA; Immunohistochemistry; ELISA, Immunohistochemistry (Frozen sections)
Host Organism: guinea pig
Clonality polyclonal
Target(s): Rat Nociceptin (PNOC)
Proper citation: LSBio (LifeSpan) Cat# LS-C73654-50, RRID:AB_1597814 Copy
http://antibodyregistry.org/AB_2289076
Comments: Useful for western blot, immunoprecipitation, immunohistochemistry
Host Organism: guinea pig
Clonality polyclonal
Target(s): Actn4
Proper citation: Enzo Life Sciences Cat# ALX-210-356, RRID:AB_2289076 Copy
http://antibodyregistry.org/AB_11193985
Comments: manufacturer recommendations: IHC, WB; Immunohistochemistry; Western Blot
Host Organism: guinea pig
Clonality polyclonal
Target(s): Keratin K18 antibody
Proper citation: Fitzgerald Industries International Cat# 20R-2634, RRID:AB_11193985 Copy
Can't find your Antibody?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific antibody, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your antibody in the search results, please help us by registering it into the system — it's easy. Register it with The Antibody Registry (an Antibody Registry account is required. Create a free Antibody Registry account if you don't have one yet). An RRID will be generated in 1-2 business days.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
