Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: http://www.wormbase.org/db/get?name=WBStrain00062616
Proper Citation: RRID:WB-STRAIN:WBStrain00062616
Description: Caenorhabditis elegans with name Y67H2A.2(bet63) IV. from WB.
Species: Caenorhabditis elegans
Synonyms: Y67H2A.2(bet63) IV.
Notes: Homozygous viable. Deletion of 2572 bp in parental strain N2. Left flanking sequence: atctatttttttaaggccgaac; Right flanking sequence: tattggcagcaagcgttgcgaa. sgRNA #1: ccatacgttgttgtggagtt; sgRNA #2: tgtgaagcggaaaaccctat.|"Made_by: Bettinger lab"
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for all resource mentions.
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for Y67H2A.2(bet63) IV..
No alerts have been found for Y67H2A.2(bet63) IV..
Source: Integrated Animals
Source Database: WormBase (WB)
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
