Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

Resource Summary Report New Search

Organism Name

him-5(e1490) V; str-74(sy1802) X.

RRID:WB-STRAIN:WBStrain00055329 RRID Copied

PDF Report How to cite

RRID:WB-STRAIN:WBStrain00055329

Copy Citation Copied

Organism Information

URL: http://www.wormbase.org/db/get?name=WBStrain00055329

Proper Citation: RRID:WB-STRAIN:WBStrain00055329

Description: Caenorhabditis elegans with name him-5(e1490) V; str-74(sy1802) X. from WB.

Species: Caenorhabditis elegans

Synonyms: him-5(e1490) V; str-74(sy1802) X.

Notes: Made_by: Heenam Park|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of str-74 in him-5(e1490) background. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GGGAATATTGTTTTCGGGAATAGAAATCCTTGC right flanking sequence: CAGACCATTCGCTCATAATTATAACAACAGTTTGATG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TATGAGCGAATGGTCTGGCA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616"

Affected Gene: WBGene00001864(him-5)|WBGene00006135(str-74)

Expand All

Genomic Alteration: WBGene00001864(him-5), WBGene00006135(str-74)

Catalog Number: WB-STRAIN:WBStrain00055329

Database: WormBase (WB)

Database Abbreviation: WB

Availability: unknown

Organism Name: him-5(e1490) V; str-74(sy1802) X.

Record Creation Time: 2024-07-16 01:26:09

Record Last Update: 2026-08-29 09:28:53

Usage and Citation Metrics

We found {{ ctrl2.mentions.all_count }} mentions in open access literature.

We have not found any literature mentions for this resource.

We are searching literature mentions for this resource.

View full usage report

Most recent articles:

{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})

Checkfor all resource mentions.

Collaborator Network

A list of researchers who have used the resource and an author search tool

Find mentions based on location

A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.

Ratings and Alerts

Report Information

No rating or validation information has been found for him-5(e1490) V; str-74(sy1802) X..

No alerts have been found for him-5(e1490) V; str-74(sy1802) X..

Data and Source Information

Source: Integrated Animals

Source Database: WormBase (WB)

About

Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.