Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: http://www.wormbase.org/db/get?name=WBStrain00005418
Proper Citation: RRID:WB-STRAIN:WBStrain00005418
Description: Caenorhabditis elegans with name acr-2(n2595 n2420) X. from WB.
Species: Caenorhabditis elegans
Synonyms: acr-2(n2595 n2420) X.
Notes: Intragenic suppression of n2420 gain of function; n2595 is a nonsense mutation of acr-2. G to A at residue 525, causing W175-STOP. (WT: CACGGAGATGTGACATGGGTCCCACCTGCAATGTT) (n2595: CACGGAGATGTGACATGAGTCCCACCTGCAATGTT). Reference: Jospin M, et al. PLoS Biol. 2009 Dec;7(12):e1000265.|"Made_by: Tammy Stawicki"
Affected Gene: WBGene00000042(acr-2)
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for resource mentions.
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for CZ9676.
No alerts have been found for CZ9676.
Source: WormBase (RRID:SCR_003098)
Description: Central data repository for nematode biology including complete genomic sequence, gene predictions and orthology assignments from range of related nematodes.Data concerning genetics, genomics and biology of C. elegans and related nematodes. Derived from initial ACeDB database of C. elegans genetic and sequence information, WormBase includes genomic, anatomical and functional information of C. elegans, other Caenorhabditis species and other nematodes. Maintains public FTP site where researchers can find many commonly requested files and datasets, WormBase software and prepackaged databases.
URL: http://www.wormbase.org
Source Database: WormBase (WB)
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
