Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes
Organism Name
CZ3715
RRID:WB-STRAIN:WBStrain00005388 RRID Copied  
PDF Report How to cite
RRID:WB-STRAIN:WBStrain00005388
Copy Citation Copied
Organism Information

URL: http://www.wormbase.org/db/get?name=WBStrain00005388

Proper Citation: RRID:WB-STRAIN:WBStrain00005388

Description: Caenorhabditis elegans with name gcy-33(ok232) V. from WB.

Species: Caenorhabditis elegans

Synonyms: gcy-33(ok232) V.

Notes: 1237bp deletion in cosmid F57F5. Break points are 743 and 1980 with respect to F57F5. Sequence at the break point is: TGAGAAGTTTATAAAAAAGTA / AAACTTAAGAGTTTTCAGTCA. Primers: ok232u1: GGATTGCTTACGTGCATC; ok232d1: ATTACATTTGCAGAAACTCG; ok232d2: CTCTTCTCACTCAAATGATG. ok232u1/d1 = 322bp product with WT allele. ok232d2/u1 = 397bp product with ok232 allele.|"Mutagen:UV/TMP"

Affected Gene: WBGene00001553(gcy-33)

Expand All
Usage and Citation Metrics

We found {{ ctrl2.mentions.all_count }} mentions in open access literature.

We have not found any literature mentions for this resource.

We are searching literature mentions for this resource.

Most recent articles:

{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})

Checkfor resource mentions.

Collaborator Network

A list of researchers who have used the resource and an author search tool

Find mentions based on location


{{ ctrl2.mentions.errors.location }}

A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.

Ratings and Alerts

No rating or validation information has been found for CZ3715.

No alerts have been found for CZ3715.

Data and Source Information

Source: WormBase (RRID:SCR_003098)
Description: Central data repository for nematode biology including complete genomic sequence, gene predictions and orthology assignments from range of related nematodes.Data concerning genetics, genomics and biology of C. elegans and related nematodes. Derived from initial ACeDB database of C. elegans genetic and sequence information, WormBase includes genomic, anatomical and functional information of C. elegans, other Caenorhabditis species and other nematodes. Maintains public FTP site where researchers can find many commonly requested files and datasets, WormBase software and prepackaged databases.
URL: http://www.wormbase.org

Source Database: WormBase (WB)