Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

Resource Summary Report New Search

Organism Name

VC3802

RRID:WB-STRAIN:WBStrain00037815 RRID Copied

PDF Report How to cite

RRID:WB-STRAIN:WBStrain00037815

Copy Citation Copied

Organism Information

URL: http://www.wormbase.org/db/get?name=WBStrain00037815

Proper Citation: RRID:WB-STRAIN:WBStrain00037815

Description: Caenorhabditis elegans with name F11A10.7(gk3769[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. from WB.

Species: Caenorhabditis elegans

Synonyms: F11A10.7(gk3769[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV.

Notes: Homozygous viable. Deletion of 857 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GATGATCAGCCGTACTATTGATACTCTATG; Right flanking sequence: TGGACGATCATGTGATTCGTGTTGACAAAG. See WormBase Variation gk3769 for details.|"Made_by: Vancouver KO Group"

Affected Gene: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)

Expand All

Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)

Catalog Number: WB-STRAIN:WBStrain00037815

Database: WormBase (WB)

Database Abbreviation: WB

Availability: available

Alternate IDs: WB-STRAIN:VC3802, CGC_VC3802

Organism Name: VC3802

Record Creation Time: 2023-02-26 05:37:04

Record Last Update: 2026-07-25 10:24:28

Usage and Citation Metrics

We found {{ ctrl2.mentions.all_count }} mentions in open access literature.

We have not found any literature mentions for this resource.

We are searching literature mentions for this resource.

View full usage report

Most recent articles:

{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})

Checkfor all resource mentions.

Collaborator Network

A list of researchers who have used the resource and an author search tool

Find mentions based on location

A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.

Ratings and Alerts

Report Information

No rating or validation information has been found for VC3802.

No alerts have been found for VC3802.

Data and Source Information

Source: Integrated Animals

Source Database: WormBase (WB)

About

Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.