Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=4139879
Proper Citation: RRID:RGD_4139879
Description: Rattus norvegicus with name SS-Nckap5em1Mcwi from RGD.
Species: Rattus norvegicus
Notes: This strain was produced by injecting ZFNs targeting the sequence ctctgaaccttcaactttcagatactgatgacaatgaa into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 6.
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for SS-Nckap5em1Mcwi.
No alerts have been found for SS-Nckap5em1Mcwi.
Source: Rat Genome Database (RGD) (RRID:SCR_006444)
Description: Database for genetic, genomic, phenotype, and disease data generated from rat research. Centralized database that collects, manages, and distributes data generated from rat genetic and genomic research and makes these data available to scientific community. Curation of mapped positions for quantitative trait loci, known mutations and other phenotypic data is provided. Facilitates investigators research efforts by providing tools to search, mine, and analyze this data. Strain reports include description of strain origin, disease, phenotype, genetics, immunology, behavior with links to related genes, QTLs, sub-strains, and strain sources.
URL: http://rgd.mcw.edu
Source Database: Rat Genome Database (RGD)