SYSTEM UPDATE: We will be performing system maintenace Saturday September 26 at 9pm to midnight Pacific Time

Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes
Organism Name
F344-ApcPirc/UwmVdrem3Hfd
RRID:RGD_408364957 RRID Copied  
PDF Report How to cite
RRID:RGD_408364957
Copy Citation Copied
Organism Information

URL: https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=408364957

Proper Citation: RRID:RGD_408364957

Description: Rattus norvegicus with name F344-ApcPirc/UwmVdrem3Hfd from RGD.

Species: Rattus norvegicus

Notes: The F344-ApcPirc rat was generated previously by ENU mutagenesis (RGD ID 1641862). These fertilized rat embryos were used with the CRISPR/Cas9 system to introduce a 5-bp deletion (CCCCG) in exon 3 of the Vdr gene. This mutant was heterozygous for the Apc mutation and homozygous for the VDR deletion. WT: GGAGGCAACAGCGGCCAGCACCTCCCTGCCCGACCCTGGTGACTTTGACCGGAACGTGCCCCGGATCTGTGGAGTGTGTGGAGACCGAGCCAC KO: GGAGGCAACAGCGGCCAGCACCTCCCTGCCCGACCCTGGTGACTTTGACCGGAACGTGG ATCTGTGGAGTGTGTGGAGACCGAGCCAC Rat Resource and Research Center (RRRC); strain ID 1033

Expand All
Usage and Citation Metrics

We found {{ ctrl2.mentions.all_count }} mentions in open access literature.

We have not found any literature mentions for this resource.

We are searching literature mentions for this resource.

Most recent articles:

{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})

Checkfor resource mentions.

Collaborator Network

A list of researchers who have used the resource and an author search tool

Find mentions based on location


{{ ctrl2.mentions.errors.location }}

A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.

Ratings and Alerts

No rating or validation information has been found for F344-ApcPirc/UwmVdrem3Hfd.

No alerts have been found for F344-ApcPirc/UwmVdrem3Hfd.

Data and Source Information

Source: Rat Genome Database (RGD) (RRID:SCR_006444)
Description: Database for genetic, genomic, phenotype, and disease data generated from rat research. Centralized database that collects, manages, and distributes data generated from rat genetic and genomic research and makes these data available to scientific community. Curation of mapped positions for quantitative trait loci, known mutations and other phenotypic data is provided. Facilitates investigators research efforts by providing tools to search, mine, and analyze this data. Strain reports include description of strain origin, disease, phenotype, genetics, immunology, behavior with links to related genes, QTLs, sub-strains, and strain sources.
URL: http://rgd.mcw.edu

Source Database: Rat Genome Database (RGD)