Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=38676452
Proper Citation: RRID:RGD_38676452
Description: Rattus norvegicus with name W-Phf24em24Iexas from RGD.
Species: Rattus norvegicus
Notes: This strain was establishe by CRISPR-Cas9 system at Osaka University. Target sequence is CCATGGGGGTGTTGATGTCCAAG (CCA is PAM sequence). Back ground strain is Crlj:Wistar (WI). This strain is line No. 24 and has a 141-bp deletion in Phf24 gene. Off-target effects (214 candidate region) have not yet been examined. National BioResource Project for the Rat in Japan
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for resource mentions.
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for W-Phf24em24Iexas.
No alerts have been found for W-Phf24em24Iexas.
Source: Rat Genome Database (RGD) (RRID:SCR_006444)
Description: Database for genetic, genomic, phenotype, and disease data generated from rat research. Centralized database that collects, manages, and distributes data generated from rat genetic and genomic research and makes these data available to scientific community. Curation of mapped positions for quantitative trait loci, known mutations and other phenotypic data is provided. Facilitates investigators research efforts by providing tools to search, mine, and analyze this data. Strain reports include description of strain origin, disease, phenotype, genetics, immunology, behavior with links to related genes, QTLs, sub-strains, and strain sources.
URL: http://rgd.mcw.edu
Source Database: Rat Genome Database (RGD)
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
