Resource Summary Report  New Search

URL: http://antibodyregistry.org/AB_2921270

Proper Citation: Takeshi Kaneko - Kyoto University Cat# eGFP1, RRID:AB_2921270

Target Antigen: artificial protein

Host Organism: guinea pig

Clonality: polyclonal

Comments: Tamamaki et a., 2000. Neurons in Golgi-stain-like images revealed by GFP-adenovirus infection in vivo. Neurosci Res 38:231– 236: "For the production of anti-GFP antibodies, the full coding sequence of GFP was amplified by polymerase chain reaction (PCR) by using the pGG16 as a template. The sequences of the primers used for the PCR were ATGGTGAGCAAGGGCGAGGA and CTTGTACAGCTCGTCCATGC. The blunt-ended PCR product was cloned into pGEX-4T2 (Amersham-Pharmacia Biotech, USA) at the SmaI site, and glutathioneS-transferase(GST)-GFP fusion protein was induced in E. coli by adding isopropyl-1-thio-beta-D-galactopyranoside (IPTG) to the medium. GFP was purified according to the protocol recommended by the manufacturer of the GST-system (Amersham-Pharmacia Biotech, USA). The purified GFP was emulsified with Freund’s complete adjuvant (Difco, USA; Johnstone and Thorpe, 1987), and injected intracutaneously into female rabbits (2 mg/animal) and guinea pigs (0.5 mg/animal). Four weeks after the immunization, the same amount of GFP emulsified with incomplete Freund’s adjuvant was injected into the animals. The sera were recovered 10–20 days after the second immunization. Antibodies were further affinity-purified with GFP-conjugated Affigel 10 gel (BioRad, USA); (2 mg GFP/1 ml gel). After 25 mg of crude g-globulin fraction was applied to 1 ml of the antigen column, the specific antibodies were eluted with 0.1 M glycine-HCl, pH2.5."